IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains

Abstract

IMGT, the international ImMunoGeneTics database (http://imgt.cines.fr) is a high quality integrated information system specializing in immunoglobulins (IG), T cell receptors (TR) and major histocompatibility complex (MHC) of human and other vertebrates. IMGT provides a common access to expertly annotated data on the genome, proteome, genetics and structure of the IG and TR, based on the IMGT Scientific chart and IMGT-ONTOLOGY. The IMGT unique numbering defined for the IG and TR variable regions and domains of all jawed vertebrates has allowed a redefinition of the limits of the framework (FR-IMGT) and complementarity determining regions (CDR-IMGT), leading, for the first time, to a standardized description of mutations, allelic polymorphisms, 2D representations (Colliers de Perles) and 3D structures, whatever the antigen receptor, the chain type, or the species. The IMGT numbering has been extended to the V-like domain and is, therefore, highly valuable for comparative analysis and evolution studies of proteins belonging to the IG superfamily.

Immunoglobulin sequence analysis and prognostication in CLL: guidelines from the ERIC review board for reliable interpretation of problematic cases

“…However, if an altered codon 118 is followed by a conserved Gly-X-Gly (G-X-G) motif (IMGT positions 119-121) in the FR4 encoded by the IGHJ gene, 24,25 it can be assumed that the rearrangement is productive and can be used for interpretation of the mutational status. Furthermore, if flow cytometry analysis demonstrates the presence of surface immunoglobulin, the rearrangement might be considered as encoding for a functional polypeptide, although formal proof of this assumption would require in vitro biosynthesis experiments.…”

Antigen-specificity and DTIC before peptide-vaccination differently shape immune-checkpoint expression pattern, anti-tumor functionality and TCR repertoire in melanoma patients

“…18 . TCR sequences were compared with published TRBV, TRBD, TRBJ and TRBC segments 67 and the CDR3 was established according to the IMGT unique numbering (CDR3-IMGT) proposed by Lefranc et al 68 …”

High throughput analysis of TCR-β rearrangement and gene expression in single T cells

“…All TCR-Vb chain sequences were extracted from the IMGT database (http://imgt.cines.fr/)). 21 For correspondence between both nomenclatures see http://imgt.cines.fr/textes/IMGTrepertoire/LocusGenes/ nomenclatures/human/TRB/TRBV/Hu_TRBVnom. html.…”

“…The degenerate forward primer VP1 (GCIITK TIYTGGTAYMGACA) targets the V region (aa31, 39-44) 21 covering 42 TCR-Vb chains, while VP2 (CTITKTWTTGGTAYCIKCAG) targets the same region with one nucleotide shift covering 11 additional TCR-Vb chains. The primer for TCR-Vb 16.1 and TCR-Vb 10.1 which were not covered by the two degenerate primers, were devised separately (VP3, TCR-Vb 16.1: ATCTTTATTGGTATCGACGT, VP4, TCR-Vb 10.1: ATGTTTACTGGTATCATAAG) and mixed with degenerate primer VP2 in the PCR reaction.…”