No abstract

The solution structure of a 15-mer nutRboxB RNA hairpin complexed with the 36-mer N-terminal peptide of the N protein (N36) from bacteriophage lambda was determined by 2D and 3D homonuclear and heteronuclear magnetic resonance spectroscopy. These 36 amino acids include the arginine-rich motif of the N protein involved in transcriptional antitermination of phage lambda. Upon complex formation with boxB RNA, the synthetic N36 peptide binds tightly to the major groove of the boxB hairpin through hydrophobic and electrostatic interactions forming a bent alpha helix. Four nucleotides of the GAAAA pentaloop of the boxB RNA adopt a GNRA-like tetraloop fold in the complex. The formation of a GAAA tetraloop involves a loop-closing sheared base pair (G6-A10), base stacking of three adenines (A7, A8, and A10), and extrusion of one nucleotide (A9) from the loop, as observed previously for the complex of N(1-22) peptide and the nutLboxB RNA [Legault, P., Li, J., Mogridge, J., Kay, L.E. & Greenblatt, J. (1998) Cell 93, 289-299]. Stacking of the bases is extended by the indole-ring of Trp18 which also forms hydrophobic contacts to the side-chains of Leu24, Leu25, and Val26. Based on the structure of the complex, three mutant peptides were synthesized and investigated by CD and NMR spectroscopy in order to determine the role of particular residues for complex formation. These studies revealed very distinct amino-acid requirements at positions 3, 4, and 8, while replacement of Trp18 with tyrosine did not result in any gross structural changes.

Bacteriophage N protein plays an essential role in transcriptional antitermination in the two-phage early operons that are critical for phage development. The inhibition of termination at intrinsic and -dependent terminators by N protein depends on recognition of an RNA element called nut 1 (N utilization) on the nascent phage transcript and on four Escherichia coli host factors (NusA, NusB, NusG, and ribosomal protein NusE). Together they form a ribonucleoprotein complex that converts the RNA polymerase into a termination-resistant form upon binding (1,2). N protein binds specifically with high affinity to phage boxB RNA, a 15-mer RNA hairpin containing a purine-rich pentaloop (3, 4).Nun protein of phage HK022 is a transcription termination factor that acts, in contrast to other termination factors, highly template-and site-specific. Nun terminates transcription uniquely on phage templates (5), competing with N protein for a common binding site, nut boxB RNA (6). Like N protein, Nun requires additional host factors (NusA, NusB, NusE, and NusG) for efficient termination, whereas the presence of NusA alone inhibits the termination activity of Nun (7). Recently it has been proposed that Nun arrests transcription by anchoring RNA polymerase to DNA (8). Both Nun and N proteins belong to the family of arginine-rich motif (ARM) binding proteins. The structures of phage N ARM peptide-boxB RNA complexes and of a phage P22 ARM N peptide-boxB RNA complex have been solved by NMR (9 -12). For both these phage peptides, a very similar mode of binding has been observed, with the peptides bound in the major groove of boxB RNA, which adopts a typical hairpin conformation closed by an apical tetraloop. MATERIALS AND METHODSSample Preparation-Unlabeled 15-nucleotide boxB RNA was synthesized by in vitro transcription using T7 polymerase, a synthetic DNA template (GCCCTTTTTCAGGGCTATAGTGAGTCGTATTA; MWG-BioTech, Ebersberg, Germany), and unlabeled nucleotide triphosphates. The RNA was purified as described previously (12). Freeze-dried boxB was resuspended in water, applied on a size exclusion column (NAP, Amersham Pharmacia Biotech) for desalting, and freeze-dried again. Nun-(10 -44) and Nun-(20 -44) were purchased from Biosyntan (Berlin, Germany).15 N-labeled N-(1-36) peptide was expressed and purified as described previously (12). 1:1 complexes between either Nun-(10 -44), , or N-(1-36) and boxB were generated by addition of small volumes of concentrated (ϳ2 mM) peptide to boxB RNA (ϳ0.2 mM). To increase concentration for two-dimensional experiments, Nun-(10 -44)-boxB RNA complex was freeze-dried and resuspended in 280 l of H 2 O or D 2 O, and Nun-(20 -44) was concentrated by centricon centrifugation to a final volume of 270 l. The samples with a concentration of 3 mM and 1.5 mM, respectively, were transferred into Shigemi microtubes.NMR Spectroscopy-All NMR experiments were recorded at 28°C for the Nun-(10 -44)-boxB RNA complex and at 30°C for the Nun-(20 -44)-boxB RNA complex on a Bruker DRX 600 spectrometer equipped with 1 H/ 13...

Ferredoxins of the [Fe2S2] type function in photosynthetic electron transport as essential electron acceptors of photosystem I. The solution structure of the 97 amino acid ferredoxin from the thermophilic cyanobacterium Synechococcus elongatus was determined by nuclear magnetic resonance spectroscopy and restrained molecular dynamics calculations. The structure consists of a four-stranded parallel/ antiparallel beta-sheet, a short two-stranded antiparallel beta-sheet, and three short helices. The overall structure is similar to the structure of the ferredoxin from Anabaena. In contrast to related ferredoxins from mesophilic organisms, this thermostable protein contains a salt bridge inside a 17-amino acid hydrophobic core.

Sumoylation regulates the activities of several members of the ETS transcription factor family. To provide a molecular framework for understanding this regulation, we have characterized the conjugation of Ets-1 with SUMO-1. Ets-1 is modified in vivo predominantly at a consensus sumoylation motif containing Lys-15. This lysine is located within the unstructured N-terminal segment of Ets-1 preceding its PNT domain. Using NMR spectroscopy, we demonstrate that the Ets-1 sumoylation motif associates with the substrate binding site on the SUMO-conjugating enzyme UBC9 (K d ϳ400 M) and that the PNT domain is not involved in this interaction. Ets-1 with Lys-15 mutated to an arginine still binds UBC9 with an affinity similar to the wild type protein, but is no longer sumoylated. NMR chemical shift and relaxation measurements reveal that the covalent attachment of mature SUMO-1, via its flexible C-terminal Gly-97, to Lys-15 of Ets-1 does not perturb the structure or dynamic properties of either protein. Therefore sumoylated Ets-1 behaves as "beads-on-a-string" with the two proteins tethered by flexible polypeptide segments containing the isopeptide linkage. Accordingly, SUMO-1 may mediate interactions of Ets-1 with signaling or transcriptional regulatory macromolecules by acting as a structurally independent docking module, rather than through the induction of a conformational change in either protein upon their covalent linkage. We also hypothesize that the flexibility of the linking polypeptide sequence may be a general feature contributing to the recognition of SUMO-modified proteins by their downstream effectors.The regulation of gene expression requires the spatial and temporal orchestration of a complex network of protein-protein and protein-DNA interactions. Central to the control of these interactions are a myriad of post-translational modifications. One such modification involves the reversible, covalent attachment of the ubiquitin-like protein SUMO.4 In addition to serving as an antagonist against ubiquitinmediated degradation, sumoylation affects a growing number of recognized biological processes, including nuclear transport, signal transduction, transcription, and DNA repair (recent reviews Refs. 1-5). However, despite extensive studies, the molecular mechanisms for this regulation, which likely arise through SUMO-dependent modulation of target protein interactions with other macromolecules, remain largely undefined (2, 6 -8).In contrast, the pathways for the sumoylation and desumoylation of target proteins are well established. After proteolytic maturation and ATP-dependent activation, SUMO family members are transferred from the heterodimeric E1-activating enzyme to Cys-93 in the single E2-conjugating enzyme, UBC9. Although E3-ligating enzymes, which facilitate the specificity and efficiency of sumoylation, have been identified, UBC9 is sufficient for conjugating SUMO to many proteins, at least in vitro (9). The final product is an isopeptide bond joining the C-terminal glycine carboxyl of SUMO with the side...