The Structure of the Coliphage HK022 Nun Protein-λ-phage boxB RNA Complex

Abstract

Bacteriophage N protein plays an essential role in transcriptional antitermination in the two-phage early operons that are critical for phage development. The inhibition of termination at intrinsic and -dependent terminators by N protein depends on recognition of an RNA element called nut 1 (N utilization) on the nascent phage transcript and on four Escherichia coli host factors (NusA, NusB, NusG, and ribosomal protein NusE). Together they form a ribonucleoprotein complex that converts the RNA polymerase into a termination-resistant form upon binding (1,2). N protein binds specifically with high affinity to phage boxB RNA, a 15-mer RNA hairpin containing a purine-rich pentaloop (3, 4).Nun protein of phage HK022 is a transcription termination factor that acts, in contrast to other termination factors, highly template-and site-specific. Nun terminates transcription uniquely on phage templates (5), competing with N protein for a common binding site, nut boxB RNA (6). Like N protein, Nun requires additional host factors (NusA, NusB, NusE, and NusG) for efficient termination, whereas the presence of NusA alone inhibits the termination activity of Nun (7). Recently it has been proposed that Nun arrests transcription by anchoring RNA polymerase to DNA (8). Both Nun and N proteins belong to the family of arginine-rich motif (ARM) binding proteins. The structures of phage N ARM peptide-boxB RNA complexes and of a phage P22 ARM N peptide-boxB RNA complex have been solved by NMR (9 -12). For both these phage peptides, a very similar mode of binding has been observed, with the peptides bound in the major groove of boxB RNA, which adopts a typical hairpin conformation closed by an apical tetraloop. MATERIALS AND METHODSSample Preparation-Unlabeled 15-nucleotide boxB RNA was synthesized by in vitro transcription using T7 polymerase, a synthetic DNA template (GCCCTTTTTCAGGGCTATAGTGAGTCGTATTA; MWG-BioTech, Ebersberg, Germany), and unlabeled nucleotide triphosphates. The RNA was purified as described previously (12). Freeze-dried boxB was resuspended in water, applied on a size exclusion column (NAP, Amersham Pharmacia Biotech) for desalting, and freeze-dried again. Nun-(10 -44) and Nun-(20 -44) were purchased from Biosyntan (Berlin, Germany).15 N-labeled N-(1-36) peptide was expressed and purified as described previously (12). 1:1 complexes between either Nun-(10 -44), , or N-(1-36) and boxB were generated by addition of small volumes of concentrated (ϳ2 mM) peptide to boxB RNA (ϳ0.2 mM). To increase concentration for two-dimensional experiments, Nun-(10 -44)-boxB RNA complex was freeze-dried and resuspended in 280 l of H 2 O or D 2 O, and Nun-(20 -44) was concentrated by centricon centrifugation to a final volume of 270 l. The samples with a concentration of 3 mM and 1.5 mM, respectively, were transferred into Shigemi microtubes.NMR Spectroscopy-All NMR experiments were recorded at 28°C for the Nun-(10 -44)-boxB RNA complex and at 30°C for the Nun-(20 -44)-boxB RNA complex on a Bruker DRX 600 spectrometer equipped with 1 H/ 13...

Structure determination and dynamics of protein–RNA complexes by NMR spectroscopy

“…For example, SELEX experiments using the protein SRp20 defined a consensus sequence (A/U)C(A/U)(A/U)C [66]. To solve the NMR structure of SRp20 in complex with RNA, a total of 13 different RNA sequences were tested by NMR 15 N-1 H HSQC for the protein and 1 H-1 H-TOCSY (TOtal Correlation SpectroscopY) for the RNA) [17]. This analysis identified the RNA sequence CAUC as the optimal sequence for obtaining good NMR spectral quality for both components of the complex and was therefore used for the structure determination of the complex [17].…”

“…Therefore, the most common way of producing peptides and proteins for NMR studies is the use of recombinant DNA technology and bacterial expression. For NMR purposes, this strategy has a major advantage because it allows the production of isotopically labeled molecules by growing bacteria in a medium free of natural nitrogen and carbon sources but supplemented with isotopically labeled chemical compounds (generally, 15 N labeled ammonium chloride, and 13 C 6 -glucose). In addition, it is possible to obtain deuterated proteins by growing bacteria in a medium containing D 2 O instead of H 2 O.…”

“…Alternatively, the affinity purification tag can be separated from the protein of interest. In the case of small peptides, removal of the affinity purification tag was often achieved using cyanogen bromide that specifically hydrolyzes peptide bonds C-terminal of methionines [7,9,15,16,19,33,42,44]. In the case of protein domains that often contain internal methionines, other methods for cleavage are generally used and involve specific proteases.…”

“…In this case, a total of 13 different RNA sequences, derived from natural binding sequences and from SELEX experiments, were used. For each RNA, the quality of the NMR signal linewidths was evaluated for the protein using 15 [159]. This approach has been used to derive the structural models of two protein-RNA complexes that have been deposited in the protein data bank [46,47].…”

“…one sample containing labeled A+C and another sample labeled G+U [34,35] or alternatively one sample labeled A+U and another sample labeled G+C [20,29]. Sometimes four complex samples of single nucleotide specific 15 N/ 13 C labeled RNA [22,39] or a combination of single and double-nucleotide specific 15 N/ 13 C labeled RNA were necessary to resolve degeneracies [1,21].…”