We isolated and characterized ten microsatellite loci for Luehea divaricata, a South American outcrossing pioneer tree species that is frequently used in reforestation programs of tropical riparian forests in Brazil. A total of 45 alleles were detected across a sample of 42 individuals, with an average number of 4.5 alleles per locus. The average polymorphic information content (PIC) was 0.546 and the observed (H O ) and expected (H E ) heterozygosity values varied from 0 to 0.929 and 0.194 to 0.821, respectively. Four loci exhibited significant deviation from Hardy-Weinberg equilibrium (P B 0.001) and 24 pair combinations of the ten loci showed significant linkage disequilibrium (P B 0.01). The primers were tested for cross amplification in nine species of the Malvaceae family. These preliminary results demonstrate the usefulness of these microsatellite loci for assessing the genetic structure of L. divaricata and related genera. Luehea divaricata Martus et Zuccarini (Malvaceae) is aSouth American outcrossing pioneer tree species that is frequently used in reforestation programs of tropical riparian forests in Brazil. This species is found from North to South of Brazil (Lorenzi 2002) occupying wet and drained areas of riparian forests. The wood of L. divaricata has been intensely used in industry to make furniture, boxes, wooden shoes, baseboard, garniture and pictureframes (Lorenzi 2002). The barks of the plants are also used in alternative medicine as anti-inflammatory and antireumatic (Bighetti et al. 2004). Besides its economical importance L. divaricata is also important to recuperate disturbed areas of riparian forest. Because of the severe devastation of Brazilian riparian forests and the human exploitation of this species, L. divaricata could be considered an endangered species in many regions. The main goal of this study was to develop and characterize microsatellite markers from L. divaricata, aiming future population genetic studies needed to guide for the conservation of the genetic resources of this species and for the recovering of disturbed riparian forests. Total genomic DNA was extracted from leaf tissue using the cetyltrimethyl ammonium bromide (CTAB) method (Doyle and Doyle 1987). Microsatellites were isolated using a hybridization-based capture methodology following the protocol described by Billotte et al. (1999) with (CT) 8 and (GT) 8 probes in the enrichment step. Approximately 5 ng of genomic DNA was digested with RsaI and the blunt-ended fragments were ligated to adaptors (RsaI-21 5 0 CTCTTGCTTACGCGTGG ACTA3 0 and RsaI-25 5 0 TAGTCCACGCGTAAGCAAGA GCACA3 0 ). Fragments containing CT and GT repeats were selected by hybridization with biotinylated oligonucleotides, complementary to the repetitive sequence and recovered by streptavidin coated magnetic beads (Dynal). Microsatellite-rich fragments were amplified by PCR with
We isolated and characterized eleven polymorphic microsatellite loci for Aegiphila sellowiana an outcrossing pioneer tree species that is frequently used in reforestation programs of tropical riparian forests in Brazil. A total of 38 alleles were detected across a sample of 45 individuals of A. sellowiana, with an average number of 3.45 alleles per locus. The average polymorphic information content (PIC) was 0.430 and the observed (H O ) and expected (H E ) heterozygosity values varied from 0.156 to 1.000 and 0.145 to 0.730, respectively. Eight loci exhibited significant deviation from Hardy-Weinberg equilibrium (P ≤ 0.001) and 32 pair combinations of loci showed significant linkage disequilibrium (P ≤ 0.001). All 11 primers were tested for cross amplification in 12 species belonging to the family Lamiaceae and 5 species belonging to the related family Verbenaceae. The sequence and diversity information obtained using these microsatellites and their cross-transferability to other species of Lamiaceae as well as Verbenaceae will increase our understanding of genetic structures and species relationships within Aegiphyla and other genera of these families.
The genus Hypochaeris has a recent evolutionary history caused by long-distance dispersal in conjunction with adaptive radiation in the South American continent. Hypochaeris lutea is a perennial herb that grows mostly at altitudes of around 1000 m in cold swamps of the southern regions of Brazil. We investigated the amplified fragment length polymorphism (AFLP) in 270 individuals representing 11 Brazilian populations of H. lutea to elucidate the population genetic structure of this species. The frequencies of polymorphic loci and gene diversity ranged from 83.42% to 91.66% and from 0.26 to 0.34, respectively. Analysis of molecular variance revealed that most of the genetic variability was found within (76.67%) rather than among (23.3%) populations, agreeing with the pattern of genetic distribution within and among populations observed in other allogamous species of Hypochaeris. A Mantel test showed no correlation between genetic and geographic distances when all populations were considered. Simulations performed using a Bayesian approach consistently identified two clusters with different admixture proportions of individuals, as also revealed by a UPGMA dendrogram of populations. The pattern of genetic structure observed in H. lutea is consistent with a process of successive colonization events by long-distance dispersal resembling the rapid and recent radiation that has been proposed to explain the origin of the South American species of Hypochaeris.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.