Isolation and characterization of ten microsatellite loci for the tree species Luehea divaricata Mart. (Malvaceae) and intergeneric transferability

Abstract

We isolated and characterized ten microsatellite loci for Luehea divaricata, a South American outcrossing pioneer tree species that is frequently used in reforestation programs of tropical riparian forests in Brazil. A total of 45 alleles were detected across a sample of 42 individuals, with an average number of 4.5 alleles per locus. The average polymorphic information content (PIC) was 0.546 and the observed (H O ) and expected (H E ) heterozygosity values varied from 0 to 0.929 and 0.194 to 0.821, respectively. Four loci exhibited significant deviation from Hardy-Weinberg equilibrium (P B 0.001) and 24 pair combinations of the ten loci showed significant linkage disequilibrium (P B 0.01). The primers were tested for cross amplification in nine species of the Malvaceae family. These preliminary results demonstrate the usefulness of these microsatellite loci for assessing the genetic structure of L. divaricata and related genera. Luehea divaricata Martus et Zuccarini (Malvaceae) is aSouth American outcrossing pioneer tree species that is frequently used in reforestation programs of tropical riparian forests in Brazil. This species is found from North to South of Brazil (Lorenzi 2002) occupying wet and drained areas of riparian forests. The wood of L. divaricata has been intensely used in industry to make furniture, boxes, wooden shoes, baseboard, garniture and pictureframes (Lorenzi 2002). The barks of the plants are also used in alternative medicine as anti-inflammatory and antireumatic (Bighetti et al. 2004). Besides its economical importance L. divaricata is also important to recuperate disturbed areas of riparian forest. Because of the severe devastation of Brazilian riparian forests and the human exploitation of this species, L. divaricata could be considered an endangered species in many regions. The main goal of this study was to develop and characterize microsatellite markers from L. divaricata, aiming future population genetic studies needed to guide for the conservation of the genetic resources of this species and for the recovering of disturbed riparian forests. Total genomic DNA was extracted from leaf tissue using the cetyltrimethyl ammonium bromide (CTAB) method (Doyle and Doyle 1987). Microsatellites were isolated using a hybridization-based capture methodology following the protocol described by Billotte et al. (1999) with (CT) 8 and (GT) 8 probes in the enrichment step. Approximately 5 ng of genomic DNA was digested with RsaI and the blunt-ended fragments were ligated to adaptors (RsaI-21 5 0 CTCTTGCTTACGCGTGG ACTA3 0 and RsaI-25 5 0 TAGTCCACGCGTAAGCAAGA GCACA3 0 ). Fragments containing CT and GT repeats were selected by hybridization with biotinylated oligonucleotides, complementary to the repetitive sequence and recovered by streptavidin coated magnetic beads (Dynal). Microsatellite-rich fragments were amplified by PCR with

Evidences of genetic bottleneck and fitness decline in <i>Luehea divaricata</i> populations from southern Brazil

“…Ten microsatellite loci developed by Ruas et al (2009) were tested, and genotypes of all samples were scored at five putatively neutral nuclear microsatellite loci (Ldiv31, Ldiv40, Ldiv48A, Ldiv55 and Ldiv58), which revealed reliable banding patterns in the gels. The PCR amplification of all loci was performed in an Eppendorf ® Thermal Cycler in 25 μL reactions, comprising 40 ng of template DNA, 1X PCR buffer, 2.5 mM MgCl 2 , 1.0 U Taq DNA polymerase (Invitrogen ® ), 0.2 mM of each dNTP and 10 μM of each primer.…”

“…The PCR amplification of all loci was performed in an Eppendorf ® Thermal Cycler in 25 μL reactions, comprising 40 ng of template DNA, 1X PCR buffer, 2.5 mM MgCl 2 , 1.0 U Taq DNA polymerase (Invitrogen ® ), 0.2 mM of each dNTP and 10 μM of each primer. PCR parameters were defined as described by Ruas et al (2009), concerning one initial cycle at 94 °C for 4 min, followed by 16 touchdown cycles of 94 °C for 30 s, 65 °C for 30 s (decreasing of 1 °C per cycle) and 72 °C for 30 s, continuing with 20 additional cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 30 s and a final extension step at 72 °C for 7 min. All fragments were separated on 30 cm 10% polyacrylamide gels, stained with silver nitrate as described by Stefenon and Nodari (2003) and photographed using a digital camera.…”

Simulating the selfing and migration of Luehea divaricata populations in the Pampa biome to investigate the conservation potential of their genetic resources

“…For the mutation settings, we simulated 5 and 10 loci that evolved according to the single-step mutation (SSM), with a proportion of 0.1 K-allele model (KAM) events, under 45 possible allelic states, according to the data obtained by Ruas et al (2009), Conson (2012, and Nagel et al (2015). A mutation rate of 0.0004 mutations per locus per generation was assumed.…”

Genetic Structure and Diversity of Brazilian Tree Species from Forest Fragments and Riparian Woods

“…Lately, this research group has been engaged in the development and inter-specific transference of microsatellite primers (SSR) for the species L. divaricata (Ruas et al, 2009), A. sellowiana (Ruas et al, 2010), P. rigida, A. polyneuron, C. xanthocarpa, C. gonocarpum and A. polyneuron. The use of SSR markers will allow more accurate estimates about the distribution of genetic variation and the effects of fragmentation and local adaptation between the species of the Tibagi River basin.…”