DNA fingerprinting of Mycobacterium tuberculosis has been shown to be a powerful epidemiologic tool. We propose a standardized technique which exploits variability in both the number and genomic position of IS6110 to generate strain-specific patterns. General use of this technique will permit comparison of results between different laboratories. Such comparisons will facilitate investigations into the international transmission of tuberculosis and may identify specific strains with unique properties such as high infectivity, virulence, or drug resistance.
A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.
We analyzed a global collection of Mycobacterium tuberculosis strains using 212 single nucleotide polymorphism (SNP) markers. SNP nucleotide diversity was high (average across all SNPs, 0.19), and 96% of the SNP locus pairs were in complete linkage disequilibrium. Cluster analyses identified six deeply branching, phylogenetically distinct SNP cluster groups (SCGs) and five subgroups. The SCGs were strongly associated with the geographical origin of the M. tuberculosis samples and the birthplace of the human hosts. The most ancestral cluster (SCG-1) predominated in patients from the Indian subcontinent, while SCG-1 and another ancestral cluster (SCG-2) predominated in patients from East Asia, suggesting that M. tuberculosis first arose in the Indian subcontinent and spread worldwide through East Asia. Restricted SCG diversity and the prevalence of less ancestral SCGs in indigenous populations in Uganda and Mexico suggested a more recent introduction of M. tuberculosis into these regions. The East African Indian and Beijing spoligotypes were concordant with SCG-1 and SCG-2, respectively; X and Central Asian spoligotypes were also associated with one SCG or subgroup combination. Other clades had less consistent associations with SCGs. Mycobacterial interspersed repetitive unit (MIRU) analysis provided less robust phylogenetic information, and only 6 of the 12 MIRU microsatellite loci were highly differentiated between SCGs as measured by G ST . Finally, an algorithm was devised to identify two minimal sets of either 45 or 6 SNPs that could be used in future investigations to enable global collaborations for studies on evolution, strain differentiation, and biological differences of M. tuberculosis.Compared to many bacterial species, Mycobacterium tuberculosis harbors relatively little genetic diversity (21, 34, 37); however, there is increasing evidence that the interstrain variation that exists is biologically significant. Clinical M. tuberculosis isolates have variable gene expression profiles (25) and have different numbers of genes deleted from their chromosome (32). In animal models, M. tuberculosis appears to engender a range of immune responses and variable degrees of virulence depending on the infecting strain (5,7,47,55). In human infections, molecular epidemiological studies have suggested that certain M. tuberculosis types, identified by DNA fingerprinting, can be especially prone to drug resistance acquisition (17, 59, 65) or to global dissemination (3, 9, 27, 40, 66,
The proportion of extrapulmonary tuberculosis cases in the United States has increased from 16% of tuberculosis cases, in 1991, to 20%, in 2001. To determine associations between the demographic, clinical, and life style characteristics of patients with tuberculosis and the occurrence of extrapulmonary tuberculosis, a retrospective case-control study was conducted. This study included 705 patients with tuberculosis, representing 98% of the culture-proven cases of tuberculosis in Arkansas from 1 January 1996 through 31 December 2000. A comparison between 85 patients with extrapulmonary tuberculosis (case patients) and 620 patients with pulmonary tuberculosis (control patients) showed women (OR, 1.98; 95% CI, 1.25-3.13), non-Hispanic blacks (OR, 2.38; 95% CI, 1.42-3.97), and HIV-positive persons (OR, 4.93; 95% CI, 1.95-12.46) to have a significantly higher risk for extrapulmonary tuberculosis than men, non-Hispanic whites, and HIV-negative persons. This study expands the knowledge base regarding the epidemiology of extrapulmonary tuberculosis and enhances our understanding of the relative contribution of host-related factors to the pathogenesis of tuberculosis.
The molecular basis for isoniazid resistance in Mycobacterium tuberculosis is complex. Putative isoniazid resistance mutations have been identified in katG, ahpC, inhA, kasA, and ndh. However, small sample sizes and related potential biases in sample selection have precluded the development of statistically valid and significant population genetic analyses of clinical isoniazid resistance. We present the first large-scale analysis of 240 alleles previously associated with isoniazid resistance in a diverse set of 608 isoniazid-susceptible and 403 isoniazid-resistant clinical M. tuberculosis isolates. We detected 12 mutant alleles in isoniazid-susceptible isolates, suggesting that these alleles are not involved in isoniazid resistance. However, mutations in katG, ahpC, and inhA were strongly associated with isoniazid resistance, while kasA mutations were associated with isoniazid susceptibility. Remarkably, the distribution of isoniazid resistance-associated mutations was different in isoniazid-monoresistant isolates from that in multidrug-resistant isolates, with significantly fewer isoniazid resistance mutations in the isoniazid-monoresistant group. Mutations in katG315 were significantly more common in the multidrug-resistant isolates. Conversely, mutations in the inhA promoter were significantly more common in isoniazid-monoresistant isolates. We tested for interactions among mutations and resistance to different drugs. Mutations in katG, ahpC, and inhA were associated with rifampin resistance, but only katG315 mutations were associated with ethambutol resistance. There was also a significant inverse association between katG315 mutations and mutations in ahpC or inhA and between mutations in kasA and mutations in ahpC. Our results suggest that isoniazid resistance and the evolution of multidrug-resistant strains are complex dynamic processes that may be influenced by interactions between genes and drugresistant phenotypes.Isoniazid (INH) is one of the most effective and specific agents for the treatment of infections with Mycobacterium tuberculosis. INH is the cornerstone of treatment for drug-susceptible tuberculosis, and it is also widely used to treat latent M. tuberculosis infections. Recent increases in INH-resistant (INH r ) and multidrug-resistant (MDR) tuberculosis are jeopardizing the continued utility of this drug (13, 61). Furthermore, the development of INH resistance is a common first step in the evolution to MDR (11). Thus, there has been considerable interest in identifying the molecular basis of INH resistance in clinical M. tuberculosis isolates.INH is a prodrug that requires activation by the catalaseperoxidase enzyme encoded by the katG gene (65). Activated INH appears to disrupt the synthesis of essential mycolic acids by inhibiting the NADH-dependent enoyl-ACP reductase enzyme encoded by inhA (45). INH resistance is likely to arise
A polymerase chain reaction (PCR) assay for the rapid detection of Mycobacterium tuberculosis in sputum samples is described. The target DNA is a 123-base pair (bp) segment of IS6110, which is repeated in the M. tuberculosis chromosome and is specific for the M. tuberculosis complex. Methodology used to lyse the mycobacteria, extract the DNA, and amplify the 123-bp target DNA is presented. The amplified PCR product is detected by examination of ethidium-bromide-stained acrylamide gels. An internal control using the same primers as the target DNA has been constructed to assess the efficacy of each individual reaction. Of 162 sputum samples tested, 82 were smear-positive for acid-fast bacilli. Of the 94 specimens from patients in whom pulmonary tuberculosis was diagnosed, 51 were culture-positive, smear-positive, or both. Fifty of these were PCR positive. Of the 42 specimens from patients with nontuberculous mycobacterial pulmonary disease, 41 were PCR negative. All 26 specimens from patients without mycobacterial infection were PCR negative. This assay provides a sensitive and specific means for the laboratory diagnosis of tuberculosis within 48 h that is relatively simple to perform.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.