DNA fingerprinting of Mycobacterium tuberculosis has been shown to be a powerful epidemiologic tool. We propose a standardized technique which exploits variability in both the number and genomic position of IS6110 to generate strain-specific patterns. General use of this technique will permit comparison of results between different laboratories. Such comparisons will facilitate investigations into the international transmission of tuberculosis and may identify specific strains with unique properties such as high infectivity, virulence, or drug resistance.

A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.

Multidrug-resistant tuberculosis is readily transmitted among hospitalized patients with AIDS. Physicians must be alert to this danger and must enforce adherence to the measures recommended to prevent nosocomial transmission of tuberculosis.

No abstract

The emergence of rifampin-resistant strains of pathogenic mycobacteria has threatened the usefulness of this drug in treating mycobacterial diseases. Critical to the treatment of individuals infected with resistant strains is the rapid identification of these strains directly from clinical specimens. It Rifampin is an important component of effective multidrug therapies for tuberculosis and leprosy; however, widespread use has led to the emergence of rifampin-resistant (Rif) strains, threatening its usefulness in treating mycobacterial diseases (4-6, 8, 26, 27). Rapid information about drug susceptibility patterns is critical to the treatment of individuals with mycobacterial disease for which rifampin is indicated. Since conventional drug susceptibility testing can require 2 to 4 weeks after growth detection (Mycobacterium tuberculosis) or up to a year (Mycobacterium leprae) in mouse footpads, improvements are needed to yield accurate analysis in a shorter time. DNA diagnostic assays have the potential to provide rapid analysis of rifampin resistance in mycobacteria because of their high degree of sensitivity and specificity and the fact that they do not rely on in vitro growth for results. Shortening the time between diagnosis and the onset of effective therapy should improve patients' survival (tuberculosis) or decrease physical deformities and ocular manifestations resulting in disabilities and blindness (leprosy).Developing such assays requires knowledge of the molecular basis of Rif' in pathogenic mycobacteria. Mutations resulting in the Rif' phenotype in prokaryotes have been mapped to the gene encoding the 1-subunit of the DNA-dependent RNA polymerase (rpoB gene) (10, 11). Recently, the entire rpoB genes of M. leprae (7) resistance have been identified in both species (8,12,28,29). To further characterize mutations associated with the Rif phenotype in M. tuberculosis, M. leprae, and other pathogenic mycobacteria, we developed a rapid PCR-based, DNA sequencing protocol targeted to a 305-bp region of rpoB. By direct DNA sequencing of PCR products, the nucleic acid sequence within this region was determined in 4 rifampinsusceptible (Rifs) and 4 Rif' strains of M. leprae and in 12 Rif' and 110 Rif' strains of M. tuberculosis. In addition, mutations were identified in this region of Rif' strains of Mycobacterium africanum and Mycobacterium avium, the latter causing frequent opportunistic infections in immunocompromised hosts. On the basis of these results we have established conditions for a PCR-heteroduplex formation assay (PCR-HDF) for the rapid detection of the Rif' phenotype in pathogenic mycobacteria. MATERUILS AND METHODSMycobacterial strains. Rifampin-susceptible and -resistant strains of M. leprae were isolated initially from homogenates of skin biopsy samples from lepromatous leprosy patients not responding to antileprosy therapy, which included rifampin, and were subsequently defined as resistant to rifampin by the standard mouse footpad drug susceptibility assay (23). These strains were amplifie...

A polymerase chain reaction (PCR) assay for the rapid detection of Mycobacterium tuberculosis in sputum samples is described. The target DNA is a 123-base pair (bp) segment of IS6110, which is repeated in the M. tuberculosis chromosome and is specific for the M. tuberculosis complex. Methodology used to lyse the mycobacteria, extract the DNA, and amplify the 123-bp target DNA is presented. The amplified PCR product is detected by examination of ethidium-bromide-stained acrylamide gels. An internal control using the same primers as the target DNA has been constructed to assess the efficacy of each individual reaction. Of 162 sputum samples tested, 82 were smear-positive for acid-fast bacilli. Of the 94 specimens from patients in whom pulmonary tuberculosis was diagnosed, 51 were culture-positive, smear-positive, or both. Fifty of these were PCR positive. Of the 42 specimens from patients with nontuberculous mycobacterial pulmonary disease, 41 were PCR negative. All 26 specimens from patients without mycobacterial infection were PCR negative. This assay provides a sensitive and specific means for the laboratory diagnosis of tuberculosis within 48 h that is relatively simple to perform.

Ethionamide (ETH) is a structural analog of the antituberculosis drug isoniazid (INH). Both of these drugs target InhA, an enzyme involved in mycolic acid biosynthesis. INH requires catalase-peroxidase (KatG) activation, and mutations in katG are a major INH resistance mechanism. Recently an enzyme (EthA) capable of activating ETH has been identified. We sequenced the entire ethA structural gene of 41 ETH-resistant Mycobacterium tuberculosis isolates. We also sequenced two regions of inhA and all or part of katG. The MICs of ETH and INH were determined in order to associate the mutations identified with a resistance phenotype. Fifteen isolates were found to possess ethA mutations, for all of which the ETH MICs were >50 g/ml. The ethA mutations were all different, previously unreported, and distributed throughout the gene. In eight of the isolates, a missense mutation in the inhA structural gene occurred. The ETH MICs for seven of the InhA mutants were >100 g/ml, and these isolates were also resistant to >8 g of INH per ml. Only a single point mutation in the inhA promoter was identified in 14 isolates. A katG mutation occurred in 15 isolates, for which the INH MICs for all but 1 were >32 g/ml. As expected, we found no association between katG mutation and the level of ETH resistance. Mutations within the ethA and inhA structural genes were associated with relatively high levels of ETH resistance. Approximately 76% of isolates resistant to >50 g of ETH per ml had such mutations.

These data suggest nosocomial transmission of multidrug-resistant tuberculosis occurred from patient to patient and from patient to health care worker and underscore the need for effective acid-fast bacilli isolation facilities and adherence to published infection control guidelines in health care institutions.