The ancestry of New World cattle was investigated through the analysis of mitochondrial and Y chromosome variation in Creoles from Argentina, Brazil, Mexico, Paraguay and the United States of America. Breeds that influenced the Creoles, such as Iberian native, British and Zebu, were also studied. Creoles showed high mtDNA diversity (H = 0.984 +/- 0.003) with a total of 78 haplotypes, and the European T3 matriline was the most common (72.1%). The African T1a haplogroup was detected (14.6%), as well as the ancestral African-derived AA matriline (11.9%), which was absent in the Iberian breeds. Genetic proximity among Creoles, Iberian and Atlantic Islands breeds was inferred through their sharing of mtDNA haplotypes. Y-haplotype diversity in Creoles was high (H = 0.779 +/- 0.019), with several Y1, Y2 and Y3 haplotypes represented. Iberian patrilines in Creoles were more difficult to infer and were reflected by the presence of H3Y1 and H6Y2. Y-haplotypes confirmed crossbreeding with British cattle, mainly of Hereford with Pampa Chaqueño and Texas Longhorn. Male-mediated Bos indicus introgression into Creoles was found in all populations, except Argentino1 (herd book registered) and Pampa Chaqueño. The detection of the distinct H22Y3 patriline with the INRA189-90 allele in Caracú suggests introduction of bulls directly from West Africa. Further studies of Spanish and African breeds are necessary to elucidate the origins of Creole cattle, and determine the exact source of their African lineages.

Twelve microsatellite loci were characterized in California mountain lions (Puma concolor) and sufficient polymorphism was found to uniquely genotype 62 animals sampled at necropsy. Microsatellite genotypes obtained using mountain lion faecal DNA matched those from muscle for all of 15 individuals examined. DNA from potential prey species and animals whose faeces could be misidentified as mountain lion faeces were reliably distinguished from mountain lions using this microsatellite panel. In a field application of this technique, 32 faecal samples were collected from hiking trails in the Yosemite Valley region where seven mountain lions previously had been captured, sampled, and released. Twelve samples yielded characteristic mountain lion genotypes, three displayed bobcat-type genotypes, and 17 did not amplify. The genotype of one of the 12 mountain lion faecal samples was identical to one of the mountain lions that previously had been captured. Three of the 12 faecal samples yielded identical genotypes, and eight new genotypes were detected in the remaining samples. This analysis provided a minimum estimate of 16 mountain lions (seven identified by capture and nine identified by faecal DNA) living in or travelling through Yosemite Valley from March 1997 to August 1998. Match probabilities (probabilities that identical DNA genotypes would be drawn at random a second time from the population) indicated that the samples with identical genotypes probably came from the same mountain lion. Our results demonstrate that faecal DNA analysis is an effective method for detecting and identifying individual mountain lions.

Deoxyribonucleic acid-based tests were used to assign paternity to 625 calves from a multiple-sire breeding pasture. There was a large variability in calf output and a large proportion of young bulls that did not sire any offspring. Five of 27 herd sires produced over 50% of the calves, whereas 10 sires produced no progeny and 9 of these were yearling bulls. A comparison was made between the paternity results obtained when using a DNA marker panel with a high (0.999), cumulative parentage exclusion probability (P(E)) and those obtained when using a marker panel with a lower P(E) (0.956). A large percentage (67%) of the calves had multiple qualifying sires when using the lower resolution panel. Assignment of the most probable sire using a likelihood-based method based on genotypic information resolved this problem in approximately 80% of the cases, resulting in 75% agreement between the 2 marker panels. The correlation between weaning weight, on-farm EPD based on pedigrees inferred from the 2 marker panels was 0.94 for the 24 bulls that sired progeny. Partial progeny assignments inferred from the lower resolution panel resulted in the generation of EPD for bulls that actually sired no progeny according to the high-P(E) panel, although the Beef Improvement Federation accuracies of EPD for these bulls were never greater than 0.14. Simulations were performed to model the effect of loci number, minor allele frequency, and the number of offspring per bull on the accuracy of genetic evaluations based on parentage determinations derived from SNP marker panels. The SNP marker panels of 36 and 40 loci produced EPD with accuracies nearly identical to those EPD resulting from use of the true pedigree. However, in field situations where factors including variable calf output per sire, large sire cohorts, relatedness among sires, low minor allele frequencies, and missing data can occur concurrently, the use of marker panels with a larger number of SNP loci will be required to obtain accurate on-farm EPD.

Background Coagulase negative Staphylococcus (CNS) species are currently the most prevalent intra-mammary pathogens causing subclinical mastitis and occasional clinical mastitis or persistent infection in lactating dairy cattle. More than 10 CNS species have been identified, but they are generally managed as one group on most dairies in the United States. However, improved management decisions and treatment outcomes may be achieved with better understanding of the prevalent species, pathogenicity and strain diversity within and across dairies. Methodology A total of 604 CNS isolates were cultured from milk samples collected during a dry-cow treatment clinical trial conducted on 6 dairy herds in 4 states in the US. All the study cows were randomized to receive 1 of the 3 different intra-mammary antimicrobial infusions (Quatermaster, Spectramast DC or ToMorrow Dry Cow) at dry-off. Milk samples were collected at dry-off, calving (0–6 days in milk, DIM), post-calving (7–13 DIM) and at mastitis events within the first 100 DIM. The CNS isolates were identified to species level by partial sequencing of the rpoβ gene, and genetic relatedness within species was investigated by phylogenetic analysis of the pulse-field gel electrophoresis profiles of the isolates. Results The major CNS species identified were S. chromogenes (48.3%), S. haemolyticus (17.9%), S. simulans and S. epidermidis (each at 6.5%). Other CNS species identified at lower frequencies included S. hominis, S. auricularis, S. sciuri, S. spp KS-SP, S. capitis, S. cohnii, S. warneri, S. pasteuri, S. xylosus, S. hyicus, S. equorum, S. microti, S. rostri, S. gallinarum, S. saprophyticus and S. succinus. Phylogenetic analyses of the major species types demonstrated an association between genetic relatedness and epidemiological distributions of S. chromogenes, S. simulans, S. haemolyticus and S. auricularis. Additionally, identical strains of S. chromogenes and S. simulans were isolated from the same udder quarter of several cows at consecutive sample stages. The rest of the minor species had no deducible genetic-epidemiological link. Discussion The observed association between genetic and epidemiological distributions indicated animal-adapted nature of four CNS species, suggesting possible host-adapted and environmental transmission of these species. Multi-stage isolation of the same udder quarter strain was evidence for chronic intra-mammary infection. Conclusion The different CNS species and strains circulating on US dairy herds were genetically diverse. Four species identified were likely udder-adapted pathogens, 2 of which caused persistent infection. Our findings are important in guiding the design of effective mastitis control strategies.

Description: A small insert genomic library was prepared withllama (Lama glama) DNA cloned into pJCP1 vector, based on procedures described by Ostrander et al. 1. Construction of library and screening of clones for CA/TG repeats was carried out by Research Genetics (Huntsville, AL). Plasmids from positive clones were sequenced on ABI 377 automated DNA sequencers (Applied Biosystem, Foster City, CA) at the Veterinary Genetics Laboratory. Primer sequences and characteristics of microsatellites are presented in Table 1. Characteristics of 8 microsatellites for South American camelids Locus Repeat motif sClone
product
ize (Alleles
n)
 rSize
ange
(bp) Genbank 
accession 
number Primer sequences (5′‐3′) LCA56 (CA)12C(CA)213516133–169AF091122ATGGTGTTTACAGGGCGTTG
GCATTACTGAAAAGCCCAGG LCA63 (GT)8(GC)4AC(GT)821814190–254AF091123TTACCCAGTCCTTCGTGGG
GGAACCTCGTGGTTATGGAA LCA65 (TG)1316914165–191AF091124TTTTTCCCCTGTGGTTGAAT
AACTCAGCTGTTGTCAGGGG LCA66 (CA)1322324220–262AF091125GTGCAGCGTCCAAATAGTCA
CCAGCATCGTCCAGTATTCA LCA68 (GT)1319410191–209AF091126TCCTGTCTGTGAGAAGGCTG
CCGAAGGAAAAATAAAATGGAA LCA70 (TA)4(CA)11(TA)2212 7211–223AF091127TTCTGATGTATGGCATAGCGA
TGGGGGTAAGAGCAGGATAA LCA71 (TA)2(CA)9137 6136–150AF091128CAGACATATACCTGTATCCGTATCTA
TTCAGTGTTTCCTCGCAATG LCA77 (GT)3A(TG)823515233–263AF091129TGTTGACTAGAGCCTTTTCTTCTTT
GGGCAAGAGAGACTGACTGG

Widespread genotyping of US dairy goat breeds for casein variants has not been reported, even though the genetic data could be of use in selective breeding programs. For instance, variability in the content of protein and solids in goat milk is attributed to allelic differences in the goat alpha(s1)-casein gene. Concentrations of alpha(s1)-casein in goat milk are positively correlated with milk components and coagulation properties. The alleles A and B are designated as strong alleles, resulting in the greatest amount of alpha(s1)-casein in goat milk, whereas the E allele produces intermediate amounts and the weak allele F produces the least concentrations of alpha(s1)-casein in goat milk. Here we report on one of the first surveys of the distribution of alpha(s1)-casein genotypes in US dairy goats. The population surveyed, consisting of a total of 257 American dairy goats representing 7 main dairy breeds, contained a greater predominance of the weaker alleles, E and F, than the strong alleles, A and B. Allele distribution was related to breed, with Toggenburg, Alpine, Saanen, and Oberhasli containing the most E and F alleles and LaMancha, Nubian, and Nigerian Dwarf the fewest. Quantification of alpha(s1)-casein production by 2-dimensional gel electrophoresis demonstrated that F/F animals had the least amount of alpha(s1)-casein protein in their milk compared with all other genotypes. The results indicate that genetic improvement of dairy goats in the United States could be achieved if an alpha(s1)-casein breeding scheme were adopted.

BackgroundErythrocyte pyruvate kinase deficiency (PK deficiency) is an inherited hemolytic anemia that has been documented in the Abyssinian and Somali breeds as well as random bred domestic shorthair cats. The disease results from mutations in PKLR, the gene encoding the regulatory glycolytic enzyme pyruvate kinase (PK). Multiple isozymes are produced by tissue-specific differential processing of PKLR mRNA. Perturbation of PK decreases erythrocyte longevity resulting in anemia. Additional signs include: severe lethargy, weakness, weight loss, jaundice, and abdominal enlargement. In domestic cats, PK deficiency has an autosomal recessive mode of inheritance with high variability in onset and severity of clinical symptoms.ResultsSequence analysis of PKLR revealed an intron 5 single nucleotide polymorphism (SNP) at position 304 concordant with the disease phenotype in Abyssinian and Somali cats. Located 53 nucleotides upstream of the exon 6 splice site, cats with this SNP produce liver and blood processed mRNA with a 13 bp deletion at the 3’ end of exon 5. The frame-shift mutation creates a stop codon at amino acid position 248 in exon 6. The frequency of the intronic SNP in 14,179 American and European cats representing 38 breeds, 76 western random bred cats and 111 cats of unknown breed is 6.31% and 9.35% when restricted to the 15 groups carrying the concordant SNP.ConclusionsPK testing is recommended for Bengals, Egyptian Maus, La Perms, Maine Coon cats, Norwegian Forest cats, Savannahs, Siberians, and Singapuras, in addition to Abyssinians and Somalis as well an any new breeds using the afore mentioned breeds in out crossing or development programs.

BackgroundDecisions to initiate conservation programmes need to account for extant variability, diversity loss and cultural and economic aspects. Molecular markers were used to investigate if putative Algarvia animals could be identified for use as progenitors in a breeding programme to recover this nearly extinct breed.Methods46 individuals phenotypically representative of Algarvia cattle were genotyped for 27 microsatellite loci and compared with 11 Portuguese autochthonous and three imported breeds. Genetic distances and factorial correspondence analyses (FCA) were performed to investigate the relationship among Algarvia and related breeds. Assignment tests were done to identify representative individuals of the breed. Y chromosome and mtDNA analyses were used to further characterize Algarvia animals. Gene- and allelic-based conservation analyses were used to determine breed contributions to overall genetic diversity.ResultsGenetic distance and FCA results confirmed the close relationship between Algarvia and southern Portuguese breeds. Assignment tests without breed information classified 17 Algarvia animals in this cluster with a high probability (q > 0.95). With breed information, 30 cows and three bulls were identified (q > 0.95) that could be used to reconstitute the Algarvia breed. Molecular and morphological results were concordant. These animals showed intermediate levels of genetic diversity (MNA = 6.0 ± 1.6, Rt = 5.7 ± 1.4, Ho = 0.63 ± 0.19 and He = 0.69 ± 0.10) relative to other Portuguese breeds. Evidence of inbreeding was also detected (Fis = 0.083, P < 0.001). The four Algarvia bulls had Y-haplotypes H6Y2 and H11Y2, common in Portuguese cattle. The mtDNA composition showed prevalence of T3 matrilines and presence of the African-derived T1a haplogroup. This analysis confirmed the genetic proximity of Algarvia and Garvonesa breeds (Fst = 0.028, P > 0.05). Algarvia cattle provide an intermediate contribution (CB = 6.18, CW = -0.06 and D1 = 0.50) to the overall gene diversity of Portuguese cattle. Algarvia and seven other autochthonous breeds made no contribution to the overall allelic diversity.ConclusionsMolecular analyses complemented previous morphological findings to identify 33 animals that can be considered remnants of the Algarvia breed. Results of genetic diversity and conservation analyses provide objective information to establish a management program to reconstitute the Algarvia breed.