Description: A small insert genomic library was prepared withllama (Lama glama) DNA cloned into pJCP1 vector, based on procedures described by Ostrander et al. 1. Construction of library and screening of clones for CA/TG repeats was carried out by Research Genetics (Huntsville, AL). Plasmids from positive clones were sequenced on ABI 377 automated DNA sequencers (Applied Biosystem, Foster City, CA) at the Veterinary Genetics Laboratory. Primer sequences and characteristics of microsatellites are presented in Table 1. Characteristics of 8 microsatellites for South American camelids Locus Repeat motif sClone product ize (Alleles n) rSize ange (bp) Genbank accession number Primer sequences (5′‐3′) LCA56 (CA)12C(CA)213516133–169AF091122ATGGTGTTTACAGGGCGTTG GCATTACTGAAAAGCCCAGG LCA63 (GT)8(GC)4AC(GT)821814190–254AF091123TTACCCAGTCCTTCGTGGG GGAACCTCGTGGTTATGGAA LCA65 (TG)1316914165–191AF091124TTTTTCCCCTGTGGTTGAAT AACTCAGCTGTTGTCAGGGG LCA66 (CA)1322324220–262AF091125GTGCAGCGTCCAAATAGTCA CCAGCATCGTCCAGTATTCA LCA68 (GT)1319410191–209AF091126TCCTGTCTGTGAGAAGGCTG CCGAAGGAAAAATAAAATGGAA LCA70 (TA)4(CA)11(TA)2212 7211–223AF091127TTCTGATGTATGGCATAGCGA TGGGGGTAAGAGCAGGATAA LCA71 (TA)2(CA)9137 6136–150AF091128CAGACATATACCTGTATCCGTATCTA TTCAGTGTTTCCTCGCAATG LCA77 (GT)3A(TG)823515233–263AF091129TGTTGACTAGAGCCTTTTCTTCTTT GGGCAAGAGAGACTGACTGG
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.