No abstract

T-cell receptor excision circles (TRECs) and κ-deleting recombination excision circles (KRECs) are recently used for detection of T or B cell lymphopenia in neonates based on region-specific cutoff levels. Here, we report cutoffs for TREC and KREC copies useful for newborn screening and/or diagnosis of primary immunodeficiency diseases (PID) in Iran. DNA was extracted from a single 3.2 mm punch of dried blood spots collected from 2160 anonymized newborns referred to two major referral health centers between 2014 and 2016. For refinement of the cutoffs, 51 patients with a definite diagnosis of severe combined immunodeficiency, X-linked agammaglobulinaemia and combined immunodeficiency, including ataxia telangiectasia, human phosphoglucomutase 3 and Janus kinase-3 deficiency, as well as 47 healthy controls were included. Samples from patients with an X-linked hyper-IgM-syndrome, Wiskott-Aldrich syndrome and DNA ligase 4 deficiency were considered as disease controls. Triplex-quantitative real-time PCR was used. Cutoffs were calculated as TRECs < 11 and KRECs < 6 copies with an ACTB > 700 copies with sensitivity of 100% for TREC and 97% for KREC. Among thirty anonymized newborn samples (1.5%) with abnormal results for TREC and/or KREC, only twenty one available cases were retested and shown to be in the normal range except for three samples (0.15%). All of the patients with a definitive diagnosis were correctly identified based on our established TREC/KREC copy numbers. Determining cutoffs for TREC/KREC is essential for correctly identifying children with PID in newborn screening. Early diagnosis of PID patients enables appropriate measures and therapies like stem cell transplantation. This article is protected by copyright. All rights reserved.

No abstract

Assessment of the number of T-cell receptor excision circles (TREC) and kappa-deleting recombination excision circles (KREC) copies has been recently described as biomarkers of newly formed T and B cells respectively. In this study, we aimed to explore the effects of demographic variables including age, gender, weight, height and ethnicity on these two episomal DNA molecules. Second, for the first time in our country, we determined the reference values of TREC and KREC copy numbers in different age groups of Iranian healthy individuals as a threshold for identifying T cell and B cell lymphopenia.  The TREC and KREC copy numbers were evaluated in 251 dried blood spot (DBS) samples from healthy volunteers (age range: 0-60 years). Six primary immunodeficiency (PID) patients were included as disease controls. TREC and KREC copies were markedly reduced with increasing age. Although the levels of TREC and KREC were higher in females than males, this difference did not reach statistical significance. These findings suggest that demographic variables including age should be considered for interpretation results of the TREC/KREC assay.

No abstract

The study results may provide valuable information for prenatal diagnosis and also for genetic counseling especially for those who have a history of primary immunodeficiency in their family.

Background: Ataxia Telangiectasia (AT) is a rare autosomal recessive neurodegenerative disease caused by mutations in the ATM gene. The gene is on chromosome 11q22-23 and codes for the protein kinase ATM, which plays an essential role in DNA damage repair. The classic neurological signs of AT include progressive cerebellar ataxia, oculomotor abnormalities, movement disorders, and cognitive dysfunction. The condition presents with multisystem involvement, leading to immunodeficiency‚ cancer predisposition, oculocutaneous telangiectasia‚ and elevated serum alpha-fetoprotein levels. In this study, we review the clinical characteristics of 13 AT patients, 3 of whom displayed novel mutations. Method : Thirteen patients with ataxia-telangiectasia from 10 unrelated families were referred to Immunology, Asthma and Allergy Research Institute, Tehran, Iran. After clinical confirmation, blood samples were collected from the patients and their parents. Genetic analysis for 8 patients was conducted using whole-exome sequencing (WES); in the other 3 patients, polymerase chain reaction (PCR) was used, followed by sequencing. The mutations found via WES were confirmed by Sanger sequencing. Results: We identified 11 different mutations in ATMgene. Two patients had mutations as compound heterozygous, while 9 other patients were homozygous for the mutations. Among these, 3 likely pathogenic mutations (ie, c.4864G>T, c.2639-1G>A, and c.7940_7970delTTCCAGCAGACCAGCCAATTACTAAACTTAA) have not been reported. All parents showed a heterozygous state. Conclusion: Our study highlights the significance of next-generation sequencing techniques in identifying novel ATMmutations in AT patients. Although all reported AT mutations reside in one gene, the absence of a mutation hotspot for this gene necessitates the use of next-generation sequencing techniques. Specifically, we identified 3 mutations that have not been reported previously, emphasizing the importance of continued research in this area. This study provides new insights into the genetic underpinnings of AT and underscores the potential clinical implications of identifying novel mutations. Further research in this area can help improve diagnosis and inform potential treatments for AT.

X-linked agammaglobulinemia (XLA) is a primary immunodeficiency caused by genetic defects in the Bruton tyrosine kinase (Btk) gene. XLA is characterized as an antibody deficiency by recurrent bacterial infections, the absence of peripheral B cells, and profound reductions in all immunoglobulin isotypes. This study aims to report the clinical and genetic features of five Iranian patients with XLA. Five male cases with recurrent bacterial infection entered this study based on clinical evaluation and Immunological screening tests. The levels of T-cell receptor excision circle (TREC) and kappa-deleting recombination excision circle (KREC) were also measured in dried blood spot (DBS) samples. Sanger sequencing was applied to PCR products of DNA samples of the patients for genetic studies. All patients were from unrelated families with a mean age of 6.7 years (2.5-11) at the time of diagnosis with 4.8 mean years of delay in diagnosis. The most frequent clinical manifestations were recurrent respiratory infections and arthritis. In these patients, five previously reported mutations were found including four mutations (p.Q496X, p.Q497X, p.R520X, and p.R641H) in the Kinase domain besides one mutation (p.L37P) in the pleckstrin homology (PH) domain. Evaluations of KREC and TREC level in patients’ DBS showed low-to-undetectable copies of KREC (0-2 copies/3.2mm DBS) with normal copies of TREC. As patients with XLA have complete immunoglobulin defects and develop severe and recurrent infections, early diagnosis would be beneficial for the improvement of their quality of life. The study results may provide valuable information for the diagnosis, genetic counseling and prenatal diagnosis for the patients and their family members and emphasize performing KREC as an early diagnostic test in patients with XLA.