amyR2, amyE+, and aroI+ alleles from an a-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage pll, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-Sall-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the oa-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the a-amylase was slightly faster than that of the parental a-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular a-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of-8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 a-amylase gene which was cloned in the Escherichia coli vector systems.
SUMMARY Three cases of Japanese patients with gyrate atrophy of the choroid and retina with hyperornithinaemia were studied clinically and biochemically. The types of disease differed in responsiveness to vitamin B6. In-vivo responsiveness to vitamin B6 was correlated with in-vitro data. It is suggested that the in-vitro examination of the influence of pyridoxal phosphate on omithine ketoacid transaminase activity in cultured fibroblasts may be useful in ascertaining the efficacy of vitamin B6 treatment in gyrate atrophy. In addition the early development of the fundus lesions was observed in one case (case 1), and the ciliary body abnormality and chorioretinal atrophy were noted in another (case 3).Large doses of vitamin B6 have been tried in the treatment of gyrate atrophy of choroid and retina since Simell and Takki' found hyperornithinaemia in these cases and several investigators2 confirmed deficient activity of omithine ketoacid aminotransferase in cultured fibroblasts or lymphocytes from the affected patients. Genetic heterogeneity of the disease in responsiveness to vitamin B6 was suggested recently.367 But a study of both in-vivo and in-vitro responsiveness to vitamin B6 has been lacking. We therefore investigated whether in-vivo responsiveness to vitamin B6 is correlated with in-vitro data. Case reportsThree patients with gyrate atrophy with hyperornithinaemia, their parents and a sister, and normal controls were examined in this study. Case 1. A 5-year-old boy was first seen at the Departments of Paediatrics and Ophthalmology of Tohoku University Hospital at the age of 2 years, because his mother noticed he had thick speech and brown hair. Delivery and development were normal. The boy was the second son of a consanguineous marriage. On examination he appeared normal, except for hyperornithinaemia (8-48 mg/dl (84-8
The precursor of Bacillus subtilis alpha-amylase contains an NH2-terminal extension of 41 amino acid residues as the signal sequence. The E. coli beta-lactamase structural gene was fused with the DNA for the promoter and signal sequence regions. Activity of beta-lactamase was expressed and more than 95% of the activity was secreted into the culture medium. DNA fragments coding for short signal sequences 28, 31, and 33 amino acids from the initiator Met were prepared and fused with the beta-lactamase structural gene. The sequences of 31 and 33 amino acid residues with Ala COOH-terminal amino acid were able to secrete active beta-lactamase from B. subtilis cells. However beta-lactamase was not secreted into the culture medium by the shorter signal sequence of 28 amino acid residues, which was not cleaved. Molecular weight analysis of the extracellular and cell-bound beta-lactamase suggested that the signal peptide of B. subtilis alpha-amylase was the first 31 amino acids from the initiator Met. The significance of these results was discussed in relation to the predicted secondary structure of the signal sequences.
A secretion vector system in Bacillus subtilis was constructed from the alpha-amylase promoter and signal sequence coding region of an alpha-amylase hyperproducing strain, B. subtilis NA64, and the major part of the plasmid pTUB4 which was derived from pUB110. When an Escherichia coli beta-lactamase gene, lacking its own promoter and signal sequence coding region, was introduced into the secretion vector system, beta-lactamase was expressed in B. subtilis. In addition, more than 95% of the enzyme synthesized was secreted into the culture medium via the secretion vector system. Secreted beta-lactamase crossreacted with rabbit antiserum raised against the E. coli enzyme.
Renotropic activity was previously demonstrated in an ovine LH preparation. This preparation was further purified with a series of chromatographic steps, and the fractions were assayed for renotropic activity in vivo by their ability to stimulate [3H]thymidine incorporation into renal DNA of castrated hypophysectomized male rats. A purified preparation could be dissociated by acid treatment into two major constituent subunits, designated alpha and beta, each of which was composed of three microheterogeneous components (subunits alpha 1-3 and beta 1-3) by reverse phase HPLC. Peptide mapping, including amino acid analyses and partial sequencing of the purified peptides, showed that 1) subunits alpha 3 and beta 3 possess the full length of the polypeptide chains, with the same amino acid sequences as those of the corresponding LH subunits alpha and beta, respectively; and 2) subunits alpha 1 and alpha 2 are complexes of three polypeptides which are missing several N-terminal residues from subunit alpha 3. Conversely, subunits beta 1 and beta 2 lack the C-terminal two residues and one residue, respectively, of subunit beta 3. Renotropic activity was not detected in any of the dissociated subunits alone, but association of alpha 1-3 with beta 1-3 reconstituted the hormonal activity with different potencies. In particular, combination of subunits alpha 3 and beta 3 (alpha 3.beta 3) yielded a potent renotropic activity with weak gonadotropic activity. The carbohydrate composition of the purified preparation exhibiting renotropic activity differed from that of a reference oLH preparation, which possessed greater gonadotropic activity but was devoid of renotropic activity. Furthermore, renotropic activity was decreased after removal of sialic acid by treatment with neuraminidase. Thus, the oligosaccharide moieties as well as the amino acid sequences of the subunits may play an important role in the expression of renotropic activity in vivo, these effects over and above those arising from differential metabolic clearance. We conclude that pituitary renotropin represents a novel activity of a LH- isoform(s) and that the posttranslational (or the artificial, i.e. during preparation) modification of the constituent LH subunits may be responsible for modulation of renotropic activity as well as the intrinsic gonadotropic activity.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.