amyR2, amyE+, and aroI+ alleles from an a-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage pll, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-Sall-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the oa-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the a-amylase was slightly faster than that of the parental a-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular a-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of-8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 a-amylase gene which was cloned in the Escherichia coli vector systems.
The regulatory gene, amyR2, and the structural gene, amyEn+, coding for N-type alpha-amylase from Bacillus subtilis N7 have been cloned in the B. subtilis plasmid pUB110. The complete nucleotide sequence of amyR2 and amyEn+ has been determined. Starting from an ATG initiator codon, there was an open reading frame comprising 477 amino acids (1,431 bp), giving a molecular weight of 52,678. The NH2-terminal portion of amyEn+ encoded a 41-amino acid-long signal sequence. The DNA nucleotide sequence was compared with the sequences of amyEm+ coding for M-type alpha-amylase from B. subtilis NA64 (Yamazaki et al. (1983) J. Bacteriol. 156, 327-337) and another B. subtilis alpha-amylase gene (Yang et al. (1983) Nucl. Acids Res. 11, 237-249). Almost all the sequences were identical in the three genes. However in the sequence of amyEn+ 32 bp of the other two alpha-amylase genes were deleted in the region from nucleotide 1,406 to 1,437. This deletion region was included in the direct repeat structure of the two genes. The reading frame downstream of the deletion region of amyEn+ shifted and a new termination codon (TGA) appeared at 26 bp downstream. Thus, the differences of the M-type and N-type alpha-amylases from amyEm+ and amyEn+ seemed to be caused by the occurrence of translation termination at different sites of the alpha-amylase gene.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.