Anti-cytokine autoantibodies in healthy individuals have been widely reported but the occurrence is variable and inconstant. We hypothesized that cytokine-binding in vivo may explain their variable and infrequent detection. Therefore, we focused on the detection of the cytokine-autoantibody complexes and found that anti-cytokine autoantibody to IL-2, IL-8, tumor necrosis factor-a, vascular endothelial growth factor and granulocyte-colony stimulating factor were present in all 15 individuals evaluated, while those to IL-3, osteopontin and macrophage-colony stimulating factor were not detected in anyone. Autoantibodies against IL-4, IL-6, IL-10, and interferon-gamma were variously detected. Thus, we discovered that anti-cytokine autoantibodies to multiple cytokines are ubiquitous in healthy individuals.
Mycoplasma pneumoniae (Mp) is a leading cause of community acquired pneumonia. Knowledge regarding Mp pneumonia obtained from animal models or human subjects has been discussed in many different reports. Accumulated expertise concerning this critical issue has been hard to apply clinically, and potential problems may remain undiscovered. Therefore, our multidisciplinary team extensively reviewed the literature regarding Mp pneumonia, and compared findings from animal models with those from human subjects. In human beings, the characteristic pathological features of Mp pneumonia have been reported as alveolar infiltration with neutrophils and lymphocytes and lymphocyte/plasma cell infiltrates in the peri-bronchovascular area. Herein, we demonstrated the novel aspects of Mp pneumonia that the severity of the Mp pneumonia seemed to depend on the host innate immunity to the Mp, which might be accelerated by antecedent Mp exposure (re-exposure or latent respiratory infection) through up-regulation of Toll-like receptor 2 expression on bronchial epithelial cells and alveolar macrophages. The macrolides therapy might be beneficial for the patients with macrolide-resistant Mp pneumonia via not bacteriological but immunomodulative effects. This exhaustive review focuses on pathogenesis and extends to some therapeutic implications such as clarithromycin, and discusses the various diverse aspects of Mp pneumonia. It is our hope that this might lead to new insights into this common respiratory disease.
The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.