This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PAM repeat region. We describe the allelic spectrum of mutational events identified at position specified by gRNA-unc-22-1000. Of above experiments we conclude: i. the trinucleotide (NGG)n PAM repeat is a receptive target for the CRISPR/Cas9 experiments in C. elegans ii. we conclude the allelic spectrum indicates the gRNA-unc-22-1000 induces fairly frequent NHEJ joining events involving deletions and indels but also, a phenotypically distinct class of small in-frame deletions indicative for microhomologymediated end-joining (MMEJ) as a result of S. pyogenes Cas9 activity at the trinucleotide (NGG)n PAM repeat region. We demonstrate guide RNA-unc-22-1000 could be used to modify complex transgenic C. elegans line expressing human beta-amyloid protein. We provide the evidence for bi-allelic transaction resulting from Cas9 action recovered in experiment in CB1138 him-6 background. We contrast the expected performance of gRNA-unc-22-1000 with guide targeting another type of C. elegans repeat embedding S. pyogenes PAM, the telomeric repeat (TTAGGC)n. We propose that preferential frame restoring MMEJ repair of the Cas9 cut at the 'modules' encoding for poly-glycine in +2(NGG)n position could be useful mode of genome engineering at the naturally occurring (NGG)n PAM embedding repeats dispersed across animal genomes.Given S. pyogenes Cas9, requires the Protospacer Adjacent Motif (NGG), for activity, we hypothesized repeats encoding for polyglycines could prove preferential targets for in vivo DNA cleavage. Below we demonstrate the RNA-guided Cas9 activity, resulting in removal of the polyglycine encoding trinucleotide stretch from unc-22 coding sequence results in variably expressive distinct twitchin phenotype. Materials and methods:Timeline.
Sticker sarcoma -a highly aneuploid, contagious neoplasm circulating in a domestic dog population -is broadly referred as a canine transmissible venereal tumour (CTVT). The karyotype of transmissible Sticker sarcoma appears as a collage of numerical and structural aberrations; the CTVT genome represents the generalized but stable neoplastic aneuploidy of monoclonal origins. Presented is an analysis of genetic events and variants underlying the aneuploid genomic structure of Sticker sarcoma described previously by Murchison et al. (2014) and Decker et al. (2015). Here we explored the above CTVT genomic compendia and mined the existing data -specifically looking for cases of convergence of multiple nonsynonymous variants onto a single gene -the mutational patterns indicative for Knudsonian 'two-hit' kinetics. A Table I is given, providing theoretical estimates of retaining the intact wild-type copy, expected as a function of a cumulative mutational convergence observed in unphased sequence consensus. We demonstrate that the two canine RecQ-like helicases: Bloom syndrome helicase and RECQL4, encoded by the aneuploid transmissible tumour, have accumulated a multitude of different mutations. Among the sets of most intensely mutated transmissible sarcoma genes, we also identified a canine FANCD2 -yet another previously unnoticed multiple-hit candidate factor. We discuss a possible role of mutated RecQ-like helicases and other cooperating factors, perceivably involved in the maintenance of the neoplastic aneuploidy. We suggest the proposed cooperative actions of CTVT RecQ-like DNA helicases could be relevant interpreting whether variants contributing to RecQ-dependent karyotypic traits, respond to selective pressures that preserve the aneuploid genomic structure of transmissible Sticker sarcoma.
We describe the construction and initial characterization of genomic resources (a set of recombinant DNA libraries, representing in total over 90, 000 independent plasmid clones), originating from the genome of a hamster adapted hookworm, Ancylostoma ceylanicum. First, with the improved methodology, we generated sets of SL1 (5'linker -GGTTAATTACCCAAGTTTGAG), and captured cDNAs from two different hookworm developmental stages: pre-infective L3 and parasitic adults. Second, we constructed a small insert (2-10kb) genomic library. Third, we generated a Bacterial Artificial Chromosome library (30-60kb). To evaluate the quality of our libraries we characterized sequence tags on randomly chosen clones and with first pass screening we generated almost a hundred novel hookworm sequence tags. The sequence tags detected two broad classes of genes: i. conserved nematode genes and ii. putative hookworm-specific proteins. Importantly, some of the identified genes encode proteins of general interest including potential targets for hookworm control. Additionally, we identified a syntenic region in the mitochondrial genome, where the gene order is shared between the freeliving nematode C. elegans and A. ceylanicum. Our results validate the use of recombinant DNA resources for comparative genomics of nematodes, including the freeliving genetic model organism C. elegans and closely related parasitic species. We discuss the potential and relevance of Ancylostoma ceylanicum data and resources generated by the recombinant DNA approach.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.