Abstract:The Common Snook, Centropomus undecimalis, inhabits riverine and marine areas of Southern Gulf of Mexico, where it is subject to intense use and exploitation. It has been reported that the genetic identification of fish stocks constitutes a valuable tool for wild population management; nevertheless, there is no available information on the genetic identification on fish stocks of this species in the region. The aim of this study was to determine the genetic relationship between C. undecimalis captured in marine and freshwater environments of the Gulf of Mexico and the San Pedro River. For this, muscle tissue samples of 79 specimens were obtained from areas located more than 300km apart. The genotype of each individual was determined using seven microsatellite primer pairs. Five primers amplified efficiently presenting between six and 28 alleles per locus. High levels of heterozygosis were observed in samples from both environments. Deviation from HWE due to an excess of heterozygotes was observed. The values of genetic difference indicate an absence of population structure (F ST =0.0075 and R ST =0.016, p=0.051) and similarity in the allele frequencies, defined by Nei's index (0.805). Data showed the existence of a high gene flow due to the number of migrants (Nm=18.7). Our results suggest that individuals living in these environments belong to the same genetic population. We suggest the development of management and protection plans for this fish species population in the wild. Rev. Biol. Trop. 62 (2): 627-636. Epub 2014 June 01.Key words: genetic diversity, microsatellite, Common Snook, Centropomus undecimalis, Grijalva-Usumacinta fluvial system, Gulf of Mexico.The Common Snook, Centropomus undecimalis, is a euryhaline species with migratory activity between marine, estuarine and fluvial environments throughout its life cycle. Its geographic range is limited to the Atlantic coast of the American continent, extending from Florida, USA, to Brazil (McMichael, Peters, & Parsons, 1989;Tringali & Bert, 1996;Tringali, Bert, & Seyoum, 1999;Taylor, Whittington, Grier, & Crabtree, 2000). Reproduction of C. undecimalis in the Gulf of Mexico has been reported to occur in subtidal areas along the coast or within estuaries and coastal lagoons. Spawning takes place between April and September at salinities ranging from 28 to 35psu (Tucker, 1987;Tringali & Bert, 1996; (Anonymous, 2006;Perera, Mendoza, Contreras, Huerta, & Pérez, 2011;Perera-García et al., 2013). Capture is strongly associated to migratory movements in freshwater ecosystems; while in the coastal zone, capture is linked to spawning events. These situations can promote stock depletion with potential detrimental effects on population conservation (Perera et al., 2011).The Grijalva-Usumacinta fluvial system is the largest in Central America; it discharges into the Gulf of Mexico at the Campeche Bank area. One of the most important tributaries of this system is the San Pedro River -a freshwater tributary-located near the border with Guatemala. This river ...
Los fitoplasmas del grupo 16SrIV causan enfermedades tipo amarillamiento letal (STAL) en palmas a nivel mundial. El fitoplasma del amarillamiento letal del cocotero (ALC) se conoce como ‘Candidatus Phytoplasma palmae’ (16SrIV-A). Al igual que en el ALC, muchas enfermedades causadas por fitoplasma a nivel mundial, sus vectores no han sido identificados. El único vector del fitoplasma del ALC incriminado es Haplaxius crudus (Hemiptera: Cixiidae). El objetivo del presente estudio fue determinar la presencia del fitoplasma 16SrIV en cíxiidos y dérbidos asociados a palmas (Adonidia merrillii y Cocos nucifera) positivas a fitoplasmas. Se realizaron capturas de insectos asociados a estas palmas durante la mañana y tarde. La presencia de fitoplasma fue determinada por PCR en tiempo real, empleando los cebadores TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) y LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT); sonda LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). No se detectó la presencia de fitoplasma del grupo 16SrIV en H. crudus aunque sí se mostró su presencia en H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) y Persis foveatis (Hemiptera: Derbidae). Estos resultados sugieren que estas tres especies pueden ser potenciales vectores del fitoplasma del grupo 16 SrIV en palmas.
The Meso-American slider turtle ( Trachemys venusta) is a freshwater turtle that is widely distributed from Mexico to Colombia. Due to the overexploitation of populations of this species in Mexico, it has been placed within the “subject to special protection” category formulated by the Official Mexican Standard NOM-059-ECOL-2010. In the state of Tabasco, Mexico, Management Units for the Conservation of Wildlife (UMA) were created to reduce the impact of overexploitation of freshwater turtles bred in captivity. However, no genetic management plan was considered. The present study was carried out in an UMA in the state of Tabasco. We obtained the level of genetic diversity of the founder individuals of the UMA in order to develop a management plan which will optimize reproduction in the UMA. Genetic diversity was compared between captive (n = 86) and wild (n = 45) individuals using 14 microsatellite molecular markers. The genetic diversity parameter determined in this study was slightly higher for captive than for wild population ( He = 0.606 and He = 0.594 respectively), reflecting the mix of genetic sources in captive group (founding individuals from different localities) and demonstrating that the captive population contains a diverse subset of alleles from representative populations. The analysis of genetic structure revealed a relationship between captive and wild populations, indicating the influence of the two principal river basins in this region on the populations structure of freshwater turtles. Finally, according to the results obtained from the relationship analysis, we recommend the use of 19 females and 13 males to constitute the appropriate breeding group, generating a potential of 247 dyads with no relationship. However, in order to improve breeding program and the genetic diversity of captive population, we suggest to introduce wild-caught individuals. These results are the first regarding genetic management in a Mexican UMA and demonstrate the importance of molecular approaches in the management and conservation of captive species.
Antillean manatees (Trichechus manatus manatus), a subspecies of the West Indian manatee, is listed as endangered species in the Red List of Threatened Species of the International Union for Conservation of Nature. The aims of this research were to survey on the possible regional genetic structure in the southern Gulf of Mexico and to compare genetic status of a landlocked population in Laguna de las Ilusiones (IL) with individuals from localities with no barriers to displacement and breed (open population [OP]). We analyzed 45 manatee skin samples collected from different locations in Tabasco (n ¼ 38, including 19 from IL), Veracruz (n ¼ 3), Campeche (n ¼ 2), and Chiapas (n ¼ 2). The genomic DNA was isolated and PCR amplifications were performed for each sample using 28 microsatellite loci, previously designed for West Indian manatees and described as polymorphic for this species. Two clusters (k ¼ 2) were identified by STRUCTURE. The analysis of both a priori populations (IL and OP) indicate that the global values of F ST and R ST (F ST ¼0.049, R ST ¼0.077) were significant. The H E for IL was 0.38 AE 0.03 and for OP was 0.49 AE 0.01. The average number of alleles N A for IL was 2.21 AE 0.09 and for OP was 2.32 AE 0.09. The overall inbreeding coefficient was F IS ¼À0.013 for analyzed populations. Genetic diversity was low. The IL population had slightly lower genetic diversity compared with OP, which could be explained by isolation of that small group, so conservation plans for IL should be considered as priority.
The Meso-American slider turtle (Trachemys venusta) is a freshwater turtle endemic to Mexico and Central America. Due to the overexploitation of its natural populations, it is in the at risk category formulated by the Official Mexican Standard NOM-059-ECOL-2010. In the state of Tabasco, Management Units for the Conservation of Wildlife (UMA) were created to reduce the impact of overexploitation of freshwater turtles. However, no genetic management plan was considered. This study presents the level of genetic diversity of the founder individuals in order to develop a management plan which will optimize reproduction in the UMA. Genetic diversity was compared between captive (n = 45) and wild (n = 86) individuals using 14 microsatellite molecular markers. Level of genetic diversity could be considered as low (He < 0.6) for a species of turtle and suggests that a higher level of protection is required for this particular species. Furthermore, values were slightly higher for the captive group reflecting the mix of genetic sources (founding individuals from different localities) and demonstrating that the captive population is genetically representative of natural populations. The genetic structure analysis revealed a relationship between captive and wild populations, indicating the influence of the two principal river basins in this region on the population of freshwater turtles. Finally, according to the results obtained from the analysis conducted using Storm and ML-Relate programs, we recommend the use of 19 females and 13 males, generating a potential of 247 dyads with no relationship. These first results of genetic management in a Mexican UMA, demonstrate the importance of molecular approaches at the time of managing and conserving species in captivity.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.