Endothelin-1 (ET-1) is a potent vasoconstrictor peptide that is also known to induce a wide spectrum of biological responses in nonvascular tissue. In this study, we found that ET-1 (100 nM) inhibited the glutamate uptake in cultured astrocytes expressing the glutamate/aspartate transporter (GLAST); astrocytes did not express the glutamate transporter-1 (GLT-1). The V(max) and the K(m) of the glutamate uptake were reduced by 57% and 47%, respectively. Application of the ET(A) and ET(B) receptor antagonists BQ-123 and BQ-788 partly inhibited the ET-1-evoked decrease in the glutamate uptake, whereas the nonspecific ET receptor antagonist bosentan completely inhibited this decrease. Incubation of the cultures with pertussis toxin abolished the effect of ET-1 on the uptake. The ET-1-induced decrease in the glutamate uptake was independent of extracellular free Ca(2+) concentration, whereas the intracellular Ca(2+) antagonists thapsigargin and 3,4,5-trimethoxybenzoic acid 8-(diethylamino)octyl ester abolished the effect of ET-1 on the glutamate uptake. Incubation with the protein kinase C (PKC) antagonist staurosporine, but not with the fatty acid-binding protein bovine serum albumin, prevented the ET-1-induced decrease in the glutamate uptake. These results suggest that ET-1 impairs the high-affinity glutamate uptake in cultured astrocytes through a G protein-coupled mechanism, involving PKC and changes in intracellular Ca(2+).

We analyzed blood samples from more than 200 normal adults, and quantified their Hb F by cation-exchange high-performance liquid chromatography. In several subjects with slightly elevated Hb F (0.4-4.3%), we determined the Ggamma levels in the Hb F and DNA sequence variations in the locus control region II and in the Ggamma and Agamma promoters. About 25% of the approximately 200 normal teenaged high school students had elevated Hb F; detailed analyses of some 20 students, selected at random, identified most as females with a homozygosity for the C-->T variation at position -158 (Ggamma). One 11-year-old boy was heterozygous for the A-->G change at position -161 (Ggamma); he and two of his relatives had approximately 4% Hb F, high Ggamma values, and a high level of (mainly) Ggamma-mRNA. Nearly 40 normal adults from Macedonia and from Georgia (mostly Caucasians) were tentatively identified as Swiss HPFH heterozygotes because slightly elevated Hb F levels were observed at least once. Many of these persons were heterozygous or homozygous for the C-->T mutation at -158 (Ggamma), and a few carried a gamma-globin gene triplication. The C-->T change appears to be an important factor predisposing the adult to increased Hb F production. Evidence suggests a gene dose effect in (mildly) anemic adults; however, other factors besides the C-->T change at -158 (Ggamma), including factors not linked to the beta-globin region, may cause an increase in gamma-chain synthesis.

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

No abstract

The article considers the effect of increasing doses of sewage sludge (OSV) on the productivity of oats in various agrometeorological conditions, as well as the effect of different doses of OSV on some agrophysical properties of the soil and humus content. In the course of the study, it was proved that with an increase in the dose of OSV, there is an increase in the lowest moisture capacity, which characterizes the water-holding capacity of the soil. With the introduction of OSV in the soil, the humus content increases (with an increase in the sediment dose to 10 t /ha of dry matter, an increase in the percentage of humus is observed by 0.1%, with the introduction of sediment at doses of 25 and 30 t /ha, the humus content in the soil increases to 1.3%). The analysis of the data allows us to conclude that the agrometeorological conditions of the year have a significant impact on the yield of oats when using different doses of OSV. Thus, in wet years, the grain increase is from 6.0 to 11.5 c/ha (20 and 25 t/ha of WT), and in normal years – from 9.5 to 20.5 c/ha (25 t/ha of WT) compared with the yield of oat grain in dry years. Keywords: SEWAGE SLUDGE, OAT PRODUCTIVITY, AGROMETEOROLOGICAL CONDITIONS, HUMUS, LOWEST MOISTURE CAPACITY, YIELD