A Study of 45,X/46,XX Mosaicism in Turner Syndrome Females: A Novel Primer Pair for the (CAG)n Repeat within the Androgen Receptor Gene

Abstract

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

Mechanisms of mosaicism, chimerism and uniparental disomy identified by single nucleotide polymorphism array analysis

“…This is further supported by the finding of full trisomy 9 in stillborn individuals and embryos (1,8). The case of X chromosome aneuploidy was a 45,X/ 47,XXX mosaic, with direct evidence for a mitotic origin and it has been hypothesized that there is selection against 45,X in the early embryo (12,34).…”

X-chromosome loss rescues Sertoli cell maturation and spermatogenesis in Klinefelter syndrome

“…Because loss of sex chromosomes in other settings shows an association to age (the number of cell divisions) (Leonova and Hanson, 1999; Pierre and Hoagland, 1972; United Kingdom Cancer Cytogenetics Group, 1992), we questioned whether loss of the additional X-chromosome in Sertoli cells of men with KS could be age-related and begin early in development. We therefore analyzed testis tissue from four fetuses with KS and one control aged gestational week (gw) 13 to 22.…”

X‑chromosome loss rescues Sertoli cell maturation and spermatogenesis in Klinefelter syndrome

“…Because loss of sex chromosomes in other settings shows an association to age (the number of cell divisions) [ 29 – 31 ], we questioned whether loss of the additional X-chromosome in Sertoli cells of men with KS could be age-related and begin early in development. We therefore analyzed testis tissue from four fetuses with KS and one control aged gestational week (gw) 13 to 22.…”