Degradation rates of most proteins in eukaryotic cells are determined by their rates of ubiquitination. However, possible regulation of the proteasome's capacity to degrade ubiquitinated proteins has received little attention, although proteasome inhibitors are widely used in research and cancer treatment. We show here that mammalian 26S proteasomes have five associated ubiquitin ligases and that multiple proteasome subunits are ubiquitinated in cells, especially the ubiquitin receptor subunit, Rpn13. When proteolysis is even partially inhibited in cells or purified 26S proteasomes with various inhibitors, Rpn13 becomes extensively and selectively polyubiquitinated by the proteasome-associated ubiquitin ligase, Ube3c/Hul5. This modification also occurs in cells during heat-shock or arsenite treatment, when poly-ubiquitinated proteins accumulate. Rpn13 ubiquitination strongly decreases the proteasome's ability to bind and degrade ubiquitin-conjugated proteins, but not its activity against peptide substrates. This autoinhibitory mechanism presumably evolved to prevent binding of ubiquitin conjugates to defective or stalled proteasomes, but this modification may also be useful as a biomarker indicating the presence of proteotoxic stress and reduced proteasomal capacity in cells or patients.

New vectors were constructed for efficient transposon Tn917-mediated mutagenesis of poorly transformable strains of Streptococcus mutans(pTV1-OK) and subsequent recovery of interrupted genes in Escherichia coli(pTV21⌬2TetM). In this report, we demonstrate the utility of Tn917 mutagenesis of a poorly transformable strain of S. mutans (JH1005) by showing (i) the conditional replication of pTV1-OK, a repA(Ts) derivative of the broad-host-range plasmid pWVO1 harboring Tn917, in JH1005 at the permissive temperature (30؇C) versus that at the nonpermissive temperature (45؇C); (ii) transposition frequencies similar to those reported for Bacillus subtilis (10 ؊5 to 10 ؊4) with efficient plasmid curing in 90 to 97% of the erythromycin-resistant survivors following a temperature shift to 42 to 45؇C; and (iii) the apparent randomness of Tn917 insertion as determined by Southern hybridization analysis and the ability to isolate nutritional mutants, mutants in acid tolerance, and mutants in bacteriocin production, at frequencies ranging from 0.1 to 0.7%. Recovery of transposon-interrupted genes was achieved by two methods: (i) marker rescue in E. coli with the recovery vector pTV21⌬2TetM, a tetracycline-resistant and ampicillin-sensitive Tn917-pBR322 hybrid, and (ii) "shotgun" cloning of genomic libraries of Tn917 mutants into pUC19. Sequence analyses revealed insertions at five different genetic loci in sequences displaying homologies to Clostridium spp. fhs (66% identity), E. coli dfp (43% identity), and B. subtilis ylxM-ffh (58% identity), icd (citC [69% identity]), and argD (61% identity). Insertions in icd and argD caused nutritional requirements; the one in ylxM-ffh caused acid sensitivity, while those in fhs and dfp caused both acid sensitivity and nutritional requirements. This paper describes the construction of pTV1-OK and demonstrates that it can be efficiently employed to deliver Tn917 into S. mutans for genetic analyses with some degree of randomness and that insertions in the chromosome can be easily recovered for subsequent characterization. This represents the first published report of successful Tn917 mutagenesis in the genus Streptococcus.

The contribution of glutamyl transpeptidase (GGT) (␥-glutamyltransferase [EC 2. 3. 2. 2]) toHelicobacter pylori virulence was investigated in piglets and mice using GGT-deficient isogenic strains. All animals became colonized. However, the bacterial load was significantly lower for mutant bacteria than for parent strains. These results suggest that GGT activity provides an advantage to H. pylori in colonization.Helicobacter pylori is a gram-negative spiral bacterium that causes gastritis and ulcers and is associated with gastric cancer (14,24,28,31). The mechanisms by which H. pylori colonizes and persists within the gastric mucosa are poorly understood. Elucidating the mechanisms involved in both survival and virulence of pathogenic bacteria is often facilitated through the use of animal models. Until recently, most H. pylori animal models were cost and space prohibitive for many researchers. These models included nonhuman primates (4,5,8,13,17), gnotobiotic piglets (11,12,21), and the domestic cat (16). Of these, the gnotobiotic piglet has been one of the most widely used and trusted models for H. pylori infection. Recently, the study of H. pylori immunity and pathogenesis has been greatly facilitated by the development of several murine models of H. pylori infection (19,22,23,32).The expansion of the number of animal models should facilitate the characterization of putative virulence and colonization factors. One such potential virulence factor is the glutamyl transpeptidase (GGT) (␥-glutamyltransferase [EC 2. 3. 2. 2]) enzyme. In mammalian tissues, GGT activity has been well studied and includes such functions as transpeptidation reactions and glutathione synthesis (35). However, GGT expression and activity in bacteria has been poorly characterized. Recently, the ggt gene for H. pylori was identified and sequenced by Chevalier et al. (7), making it one of only several bacterial species in which the ggt gene has been characterized (18,34,38). Chevalier et al. reported that deletion of GGT had no deleterious effect on the ability of H. pylori to grow in culture, but GGT is essential for H. pylori infection of the mouse (7). The present study was performed to extend the findings of Chevalier et al. by employing isogenic, GGT-deficient H. pylori mutants in the gnotobiotic-piglet model. However, we now report, using two distinct animal models, that although GGT activity may provide some advantage to H. pylori in colonization of the gastric mucosa, it is not essential for initial colonization or maintenance of chronic infection.The ggt::aph insertional mutation was constructed utilizing the sequence of the ggt gene (open reading frame 1118) from the database of The Institute for Genomic Research. The 5Ј end of the gene was amplified with primer GTHPF4 (CATC GTCTCTTGTAATGAG) and primer GTHPR5 (CGACGAG ATCTCGCTGCCGAAGCGATGCG). The 3Ј end of the gene was amplified with primer GTHPF5 (CGACGAGATCTCTC CCGAACTTGGCGGCG) and primer GTHPR4 (GCATCA TGTAAGTTATAAGCG). Each fragment was cloned into pCRscript plasmids (Stratagen...

Streptococcus mutans JH1000 and its derivatives were previously shown (J. D. Hillman, K. P. Johnson, and B. I. Yaphe, Infect. Immun. 44:141–144, 1984) to produce a low-molecular-weight, broad-spectrum bacteriocin-like inhibitory substance (BLIS). The thermosensitive vector pTV1-OK harboring Tn917 was used to isolate a BLIS-deficient mutant, DM25, and the mutated gene was recovered by shotgun cloning inEscherichia coli. Sequence analysis of insert DNA adjacent to Tn917 led to the identification of four open reading frames including two (lanA and lanB) which have substantial homology to the Staphylococcus epidermidisstructural gene (epiA) and a modifying enzyme gene (epiB) for biosynthesis of the lantibiotic epidermin, respectively. Although the BLIS activity could not be recovered from broth cultures, high yields were obtained from a solid medium consisting of Todd-Hewitt broth containing 0.5% agarose that was stab inoculated with JH1140 (a spontaneous mutant of JH1000 that produces threefold-elevated amounts of activity). Agar could not substitute for agarose. Chloroform extraction of the spent medium produced a fraction which yielded two major bands on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The faster-migrating band was absent in chloroform extracts of the mutant, DM25. The amino acid sequence of this band was determined by Edman sequencing and mass spectroscopy. The results showed that it is a lantibiotic, which we have named mutacin 1140, and that the sequence corresponded to that deduced from thelanA sequence. We observed a number of similarities of mutacin 1140 to epidermin and an S. mutans lantibiotic, B-Ny266, but it appears to have significant differences in the positions of its thioether bridges. It also has other unique features with regard to its leader sequence and posttranslational modification. A proposed structure for mutacin 1140 is presented.