γ-Glutamyltransferase Is a Helicobacter pylori Virulence Factor but Is Not Essential for Colonization

Abstract

The contribution of glutamyl transpeptidase (GGT) (␥-glutamyltransferase [EC 2. 3. 2. 2]) toHelicobacter pylori virulence was investigated in piglets and mice using GGT-deficient isogenic strains. All animals became colonized. However, the bacterial load was significantly lower for mutant bacteria than for parent strains. These results suggest that GGT activity provides an advantage to H. pylori in colonization.Helicobacter pylori is a gram-negative spiral bacterium that causes gastritis and ulcers and is associated with gastric cancer (14,24,28,31). The mechanisms by which H. pylori colonizes and persists within the gastric mucosa are poorly understood. Elucidating the mechanisms involved in both survival and virulence of pathogenic bacteria is often facilitated through the use of animal models. Until recently, most H. pylori animal models were cost and space prohibitive for many researchers. These models included nonhuman primates (4,5,8,13,17), gnotobiotic piglets (11,12,21), and the domestic cat (16). Of these, the gnotobiotic piglet has been one of the most widely used and trusted models for H. pylori infection. Recently, the study of H. pylori immunity and pathogenesis has been greatly facilitated by the development of several murine models of H. pylori infection (19,22,23,32).The expansion of the number of animal models should facilitate the characterization of putative virulence and colonization factors. One such potential virulence factor is the glutamyl transpeptidase (GGT) (␥-glutamyltransferase [EC 2. 3. 2. 2]) enzyme. In mammalian tissues, GGT activity has been well studied and includes such functions as transpeptidation reactions and glutathione synthesis (35). However, GGT expression and activity in bacteria has been poorly characterized. Recently, the ggt gene for H. pylori was identified and sequenced by Chevalier et al. (7), making it one of only several bacterial species in which the ggt gene has been characterized (18,34,38). Chevalier et al. reported that deletion of GGT had no deleterious effect on the ability of H. pylori to grow in culture, but GGT is essential for H. pylori infection of the mouse (7). The present study was performed to extend the findings of Chevalier et al. by employing isogenic, GGT-deficient H. pylori mutants in the gnotobiotic-piglet model. However, we now report, using two distinct animal models, that although GGT activity may provide some advantage to H. pylori in colonization of the gastric mucosa, it is not essential for initial colonization or maintenance of chronic infection.The ggt::aph insertional mutation was constructed utilizing the sequence of the ggt gene (open reading frame 1118) from the database of The Institute for Genomic Research. The 5Ј end of the gene was amplified with primer GTHPF4 (CATC GTCTCTTGTAATGAG) and primer GTHPR5 (CGACGAG ATCTCGCTGCCGAAGCGATGCG). The 3Ј end of the gene was amplified with primer GTHPF5 (CGACGAGATCTCTC CCGAACTTGGCGGCG) and primer GTHPR4 (GCATCA TGTAAGTTATAAGCG). Each fragment was cloned into pCRscript plasmids (Stratagen...

Genome Sequence and Analysis of the Oral Bacterium Fusobacterium nucleatum Strain ATCC 25586

“…Based on PSORT analysis, one of them is periplasmic and the other is membrane bound. A periplasmic ␥-glutamyl-transpeptidase, characterized by Mineyama and Saito (29), is similar to one from Helicobacter pylori that is involved in virulence (7,28).…”

Helicobacter pylori-Induced Disruption of Monolayer Permeability and Proinflammatory Cytokine Secretion in Polarized Human Gastric Epithelial Cells

“…Pathogenicity island-deficient (CagPAI Ϫ ) and VacA-deficient (VacA Ϫ ) derivative strains of H. pylori 26695 were obtained from Ellen Beswick (University of New Mexico, Albuquerque, NM). H. pylori strains M5 and HpM5ureB were generated by our laboratory as described previously (23). All H. pylori strains were grown on Columbia blood agar (Difco, Detroit, MI) containing 7% defibrinated horse blood (Hemostat Laboratories, Dixon, CA), amphotericin B (2.5 g/ml), and the selective antibiotics trimethoprim (20 g/ml), vancomycin (6 g/ml), and cefsulodin (16 g/ml).…”

Identification of Helicobacter pylori Genes That Contribute to Stomach Colonization

“…In order to perform selections in vivo, we used genomic DNA from the original library to transfer the library mutations by natural transformation and homologous recombination into two genetically distinct mouse-adapted strains, NSH79 and NSH57 (see Materials and Methods). There have been increasing reports of strain-specific effects on colonization from null mutations of candidate virulence genes (14,17,35,36). By querying two different strain backgrounds, we hoped to illuminate which genes have a universal impact on colonization and which have strain-specific effects.…”