Multivalency as a key principle in nature has been successfully adopted for the design and synthesis of artificial glycoligands by attaching multiple copies of monosaccharides to a synthetic scaffold. Besides their potential in various applied areas, e.g. as antiviral drugs, for the vaccine development and as novel biosensors, such glycomimetics also allow for a deeper understanding of the fundamental aspects of multivalent binding of both artificial and natural ligands. However, most glycomimetics so far neglect the purposeful arranged heterogeneity of their natural counterparts, thus limiting more detailed insights into the design and synthesis of novel glycomimetics. Therefore, this work presents the synthesis of monodisperse glycooligomers carrying different sugar ligands at well-defined positions along the backbone using for the first time sequential click chemistry and stepwise assembly of functional building blocks on solid support. This approach allows for straightforward access to sequence-defined, multivalent glycooligomers with full control over number, spacing, position, and type of sugar ligand. We demonstrate the synthesis of a set of heteromultivalent oligomers presenting mannose, galactose, and glucose residues. All heteromultivalent structures show surprisingly high affinities toward Concanavalin A lectin receptor in comparison to their homomultivalent analogues presenting the same number of binding ligands. Detailed studies of the ligand/receptor interaction using STD-NMR and 2fFCS indeed indicate a change in binding mechanism for trivalent glycooligomers presenting mannose or combinations of mannose and galactose residues. We find that galactose residues do not participate in the binding to the receptor, but they promote steric shielding of the heteromultivalent glycoligands and thus result in an overall increase in affinity. Furthermore, the introduction of nonbinding ligands seems to suppress receptor clustering of multivalent ligands. Overall these results support the importance of heteromultivalency specifically for the design of novel glycoligands and help to promote a fundamental understanding of multivalent binding modes.

Mammalian C-type lectin receptors (CTLRS) are involved in many aspects of immune cell regulation such as pathogen recognition, clearance of apoptotic bodies, and lymphocyte homing. Despite a great interest in modulating CTLR recognition of carbohydrates, the number of specific molecular probes is limited. To this end, we predicted the druggability of a panel of 22 CTLRs using DoGSiteScorer. The computed druggability scores of most structures were low, characterizing this family as either challenging or even undruggable. To further explore these findings, we employed a fluorine-based nuclear magnetic resonance screening of fragment mixtures against DC-SIGN, a receptor of pharmacological interest. To our surprise, we found many fragment hits associated with the carbohydrate recognition site (hit rate = 13.5%). A surface plasmon resonance-based follow-up assay confirmed 18 of these fragments (47%) and equilibrium dissociation constants were determined. Encouraged by these findings we expanded our experimental druggability prediction to Langerin and MCL and found medium to high hit rates as well, being 15.7 and 10.0%, respectively. Our results highlight limitations of current in silico approaches to druggability assessment, in particular, with regard to carbohydrate-binding proteins. In sum, our data indicate that small molecule ligands for a larger panel of CTLRs can be developed.

DC-SIGN is a cell-surface receptor for several pathogenic threats, such as HIV, Ebola virus, or Mycobacterium tuberculosis. Multiple attempts to develop inhibitors of the underlying carbohydrate-protein interactions have been undertaken in the past fifteen years. Still, drug-like DC-SIGN ligands are sparse, which is most likely due to its hydrophilic, solvent-exposed carbohydrate-binding site. Herein, we report on a parallel fragment screening against DC-SIGN applying SPR and a reporter displacement assay, which complements previous screenings using F NMR spectroscopy and chemical fragment microarrays. Hit validation by SPR and H- N HSQC NMR spectroscopy revealed that although no fragment bound in the primary carbohydrate site, five secondary sites are available to harbor drug-like molecules. Building on key interactions of the reported fragment hits, these pockets will be targeted in future approaches to accelerate the development of DC-SIGN inhibitors.

Receptor Expression and Purification General remarks Codon-optimized genes for the expression of Langerin in E. coli were purchased from GenScript. All growth media or chemicals used for receptor expression and purification were purchased from Carl Roth if not stated otherwise. Langerin ECD The truncated Langerin ECD (residues 148 to 328, forward primer: GGTGGTCATATGGCCTCGAC GCTGAATGCCCAGATTCCGG, reverse primer: ACCACCAAGCTTTTATTTTTCAAACTGCGG ATG) was cloned with a C-terminal TEV cleavage site and a Strep-tag II into a pET30a expression vector (EMD Millipore) and expressed insolubly in E. coli BL21 * (DE3) (Invitrogen). Precultures were incubated overnight in LB medium supplemented with 35 µg•ml-1 Kanamycin (50 ml) at 37° C and 220 rpm. The preculture was diluted to an OD 600 of 0.1 into LB medium supplemented with 35 mg•ml-1 Kanamycin (500 ml). The culture was incubated at 37° C and 220 rpm and expression of the Langerin ECD was induced with 0.5 mM IPTG at an OD 600 of 0.6 to 0.8. Cells were harvested 4 h after induction via centrifugation at 4000 g and 4° C for 20 min. Cell pellets were stored overnight at-20° C and subsequently resuspended in 50 mM Tris with 0.1% Triton X-100 and 10 mM MgCl 2 (20 ml) at pH 7.5. Lysozyme (Sigma Aldrich) was added and the sample was incubated for 3.5 h at 4° C. After the addition of DNase I (AppliChem) the sample was incubated for another 30 min at 4° C.

Glycan-binding proteins are key components of central physiological and cellular processes such as self-/non-self-recognition, cellular tissue homing, and protein homeostasis. Herein, C-type lectins are a diverse protein family that play important roles in the immune system, rendering them attractive drug targets. To evaluate C-type lectin receptors as target proteins for small-molecule effectors, chemical probes are required, which are, however, still lacking. To overcome the supposedly poor druggability of Ctype lectin receptors and to identify starting points for chemical probe development, we screened murine langerin using 1 H and 19 F NMR against a library of 871 drug-like fragments. Subsequently, hits were validated by surface plasmon resonance and enzyme-linked lectin assay. Using structure−activity relationship studies and chemical synthesis, we identified thiazolopyrimidine derivatives with double-digit micromolar activity that displayed langerin selectivity. Based on 1 H− 15 N HSQC NMR and competitive binding and inhibition experiments, we demonstrate that thiazolopyrimidines allosterically inhibit langerin. To the best of our knowledge, this is the first report of drug-like allosteric inhibitors of a mammalian lectin.

The recognition of pathogen surface polysaccharides by glycan-binding proteins is a cornerstone of innate host defense. Many members of the C-type lectin receptor family serve as pattern recognition receptors facilitating pathogen uptake, antigen processing, and immunomodulation. Despite the high evolutionary pressure in host-pathogen interactions, it is still widely assumed that genetic homology conveys similar specificities. Here, we investigate the ligand specificities of the human and murine forms of the myeloid C-type lectin receptor langerin for simple and complex ligands augmented by structural insight into murine langerin. Although the two homologs share the same three-dimensional structure and recognize simple ligands identically, a screening of more than 300 bacterial polysaccharides revealed highly diverging avidity and selectivity for larger and more complex glycans. Structural and evolutionary conservation analysis identified a highly variable surface adjacent to the canonic binding site, potentially forming a secondary site of interaction for large glycans.

No abstract

No abstract