Adenosine deaminase (ADA) is expressed ubiquitously by diverse mammalian cells and tissues but at levels that vary according to tissue and species. In humans, the thymus exhibits levels of the enzyme up to 100-fold higher than most other tissues. Using transgenic mice, we identified human ADA gene regulatory domains. Up to 3.7 kb of 5'-flanking and first exon DNA from the human ADA gene failed to promote the expression of a chloramphenicol acetyl transferase (CAT) reporter gene in an efficient, reproducible, or tissue-appropriate manner in transgenic mice. However, when 12.8 kb of DNA from the first intron of the human ADA gene was placed 3' of CAT-coding and -processing sequences, transgenic mice reproducibly expressed CAT activity in most tissues, with profoundly high levels in the thymus. DNase I hypersensitivity studies demonstrated that among transgenic mouse tissues, human thymus, and a variety of human cell lines, a region of the intron 4-10 kb downstream of the first exon exhibited an array of hypersensitive sites that varied according to tissue and cell type. Deletion of this region from the gene construction eliminated high-level expression in transgenic mice. In transfection-transient expression assays, the 12.8-kb intron fragment exhibited enhancer activity in several cell types. A 1.3-kb fragment encompassing two of the hypersensitive sites exhibited some of these activities. The results of these studies suggest that the diverse pattern of human ADA gene expression is determined, in part, by a cluster of cis-regulatory elements contained within its large first intron.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-lac, ,E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

No abstract

The nucleotide sequence of the human adenosine deaminase gene was determined. The gene was isolated in a series of overlapping lambda phage clones containing human germ line DNA. A total of 36,741 base pairs were sequenced, including 32,040 base pairs from the transcription initiation site to the polyadenylation site, 3935 base pairs of 5'-flanking DNA, and 766 base pairs of 3'-flanking DNA. The gene contains 12 exons separated by 11 introns. The exons range in size from 62 to 325 base pairs while the introns are 76-15 166 base pairs in size. The area sequenced contains 23 copies of Alu repetitive DNA and a single copy of an "O" family repeat. All but one of these repeat sequences are located in the first three introns or the 5'-flanking region. The apparent promoter region of the gene lacks the "TATA" and "CAAT" sequences often found in eucaryotic promoters and is extremely G/C rich. Contained within this region are areas homologous to other G/C-rich promoters, including six decanucleotide sequences that are highly homologous to sequences identified as functional binding sites for transcription factor Sp1.