Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

Abstract

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-lac, ,E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Position‐independent, high‐level, and correct regional expression of the rat aldolase C gene in the central nervous system of transgenic mice

“…Such expression was first described by Grosveld et al (1987). Several other genes are reportedly expressed independently of the site of integration in transgenic mice (Abe and Ohshima, 1990;Aronow et al, 1992;Bonifer et al, 1990;Chamberlain et al, 1991;Greaves et al, 1989;Greer et al, 1990;Grosveld et al, 1987). These genes contain the sequence required for transcriptional insulation, which excludes a transcriptional influence from neighboring genes.…”

Diverse developing mouse lineages exhibit high-level c-Myb expression in immature cells and loss of expression upon differentiation

“…E, bright®eld, F, dark®eld. Mouse embryos and tissues were prepared for cryosectioning and subjected to in situ hybridization analysis as previously described (Aronow et al, 1989(Aronow et al, , 1992) using amino-terminal 0.6 kb HindIII ± EcoRI fragments from pRSVmyb (Cuddihy et al, 1993) subcloned into pBluescript SK + (Stratagene) and linearized with HindIII or EcoRI. Sense and antisense transcripts were labeled using a-35 S-UTP.…”

Expression pattern of CD2 locus control region containing retroviral vectors in hemopoietic cells in vitro and in vivo

“…10 Several LCRs have been isolated of which the human ␤-globin LCR is the one most extensively studied. [11][12][13][14][15][16][17] Here, our aim is to ensure expression of retrovirally introduced genes in T cells. This is of particular interest for gene therapy approaches in the treatment of AIDS and various hemopoietic malignancies.…”