Currently, many viruses are classified based on their genome organization and nucleotide/amino acid sequence identities of their capsid and replication-associated proteins. Although biological traits such as vector specificities and host range are also considered, this later information is scarce for the majority of recently identified viruses, characterized only from genomic sequences. Accordingly, genomic sequences and derived information are being frequently used as the major, if not only, criteria for virus classification and this calls for a full review of the process. Herein, we critically addressed current issues concerning classification of viruses in the family Betaflexiviridae in the era of high-throughput sequencing and propose an updated set of demarcation criteria based on a process involving pairwise identity analyses and phylogenetics. The proposed framework has been designed to solve the majority of current conundrums in taxonomy and to facilitate future virus classification. Finally, the analyses performed herein, alongside the proposed approaches, could be used as a blueprint for virus classification at-large.

In this study, we describe a novel putative Enamovirus member, Grapevine enamovirus-1 (GEV-1), discovered by high-throughput sequencing (HTS). A limited survey using HTS of 17 grapevines (Vitis spp.) from the south, southeast, and northeast regions of Brazil led to the detection of GEV-1 exclusively on southern plants, infecting four grapevine cultivars (Cabernet Sauvignon, Semillon, CG 90450, and Cabernet franc) with a remarkable identity of around 99% at the nucleotide level. This novel virus was only detected in multiple-virus infected plants exhibiting viral-like symptoms. GEV-1 was also detected on a cv. Malvasia Longa by RT-PCR. We performed graft-transmissibility assays on GEV-1. The organization, products, and cis-acting regulatory elements of GEV-1 genome are also discussed here. The near complete genome sequence of GEV-1 was obtained during the course of this study, lacking only part of the 3' untranslated terminal region. This is the first report of a virus in the family Luteoviridae infecting grapevines. Based on its genomic properties and phylogenetic analyses, GEV-1 should be classified as a new member of the genus Enamovirus.

BACKGROUND In Brazil the implementation of the Sentinel Surveillance System of Influenza began in 2000. Central public health laboratories use reverse transcription-quantitative polymerase chain reaction (RT-qPCR) for diagnosis of respiratory viruses, but this protocol identifies only specific targets, resulted in inconclusive diagnosis for many samples. Thus, high-throughput sequencing (HTS) would be complementary method in the identification of pathogens in inconclusive samples for RT-qPCR or other specific detection protocols.OBJECTIVES This study aimed to detect unidentified viruses using HTS approach in negative samples of nasopharynx/tracheal secretions by the standard RT-qPCR collected in the Federal District, Brazil.METHODS Nucleic acids were extracted from samples collected in winter period of 2016 and subjected to HTS. The results were confirmed by the multiplex PR21 RT-qPCR, which identifies 21 respiratory pathogens.FINDINGS The main viruses identified by HTS were of families Herpesviridae, Coronaviridae, Parvoviridae and Picornaviridae, with the emphasis on rhinoviruses. The presence of respiratory viruses in the samples was confirmed by the PR21 multiplex RT-qPCR. Coronavirus, enterovirus, bocavirus and rhinovirus were found by multiplex RT-qPCR as well as by HTS analyses.MAIN CONCLUSIONS Wide virus diversity was found by different methodologies and high frequency of rhinovirus occurrence was confirmed in population in winter, showing its relevance for public health.

Tomato chlorotic spot virus (TCSV) and groundnut ringspot virus (GRSV) share several genetic and biological traits. Both of them belong to the genus Tospovirus (family Peribunyaviridae), which is composed by viruses with tripartite RNA genome that infect plants and are transmitted by thrips (order Thysanoptera). Previous studies have suggested several reassortment events between these two viruses, and some speculated that they may share one of their genomic segments. To better understand the intimate evolutionary history of these two viruses, we sequenced the genomes of the first TCSV and GRSV isolates ever reported. Our analyses show that TCSV and GRSV isolates indeed share one of their genomic segments, suggesting that one of those viruses may have emerged upon a reassortment event. Based on a series of phylogenetic and nucleotide diversity analyses, we conclude that the parental genotype of the M segment of TCSV was either eliminated due to a reassortment with GRSV or it still remains to be identified.

No abstract

Grapevines can host up to 86 virus species, some of which affect plant vigor, production and fruit quality (Fuchs, 2020). In 2014, a Vitis vinifera cv. Semillon vine showing yellow speckles and mild leafroll symptoms in Bento Gonçalves, RS, Brazil, was investigated for viruses (Silva et al., 2017), resulting in the detection of grapevine enamovirus 1, grapevine yellow speckle viroid 1 and hop stunt viroid. Total nucleic acids (TNA) extracts from this sample were enriched for dsRNA (Valverde et al., 1990), prepped with TruSeq Stranded mRNA kit (Illumina, USA), then subjected to high throughput sequencing (HTS) on the Illumina HiSeq 2000 platform. The HTS yielded 13,214 Mbp raw reads, which were trimmed and the host derived sequences subtracted with Trimmomatic and Burrows-Wheeler Aligner softwares, respectively. The remaining reads were subjected to taxonomic assignment with the Kaiju webserver, preliminarily indicating 26 reads related to citrus virga-like virus (Matsumura et al., 2017). De novo assembled contigs built by SPAdes generated five contigs that were subjected to tBLASTx searches against the NCBI viral RefSeq. Four sets of primers were designed to sequence the gaps between these contigs and the PCR amplicons were sequenced by Sanger method resulting in two long contigs. A third long contig related to citrus jingmen-like virus (Matsumura et al., 2017) was also retained for further analysis. BLASTn analyses of the assembled virus contigs showed that they are closely related to grapevine associated jivivirus 1 (GaJV-1) (Chiapello et al, 2020). The derived partial tripartite genomic sequences of GaJV-1 isolate SEM-BR from Brazil (GenBank acc. nos. MT657278-MT657280) covered 84.4% (3424 nt), 40.3% (1289 nt) and 73% (1555 nt) of RNAs 1, 2 and 3 of isolate DMG 109 from Italy (MN520745-MN520747), respectively. The pairwise nt sequence identities between both isolates were 99.3% (RNA1), 97.1% (RNA2) and 100% (RNA3), indicating that they are highly identical to each other. To confirm the HTS results, fresh TNA extracts from SEM-BR and four newly sampled vines were screened by RT-PCR using specific primers F (5’GGACGAAGTCACAACCAACACAGTTT3’) and R (5’CGCGAGTAGGTCTGACAACTTTCATTAT3’), designed based on GaJV-1 RNA1. The resulting 478 bp amplicons were sequenced (MT657281-MT657285) and found to share 99.4%-99.8% nt identities with the corresponding sequences of GaJV-1 SEM-BR (MT657278). To assess graft-transmissibility of GaJV-1, Semillon scions of SEM-BR source vine were grafted onto 14 GaJV-1-free 1103P rootstocks. Six of 14 recipient plants (all asymptomatic) tested positive for GaJV-1 by RT-PCR 106 days after grafting. Additionally, RT-PCR screening of a Brazilian grapevine collection block resulted in the detection of GaJV-1 in nine of 33 tested vines of different accessions (27.3%). The GaJV-1 positive vines included eight commercial cultivars (Ancelotta, Aragonez, Merlot, Semillon, Michele Palieri, Malvasia, Viognier, and Pinot Nero). This is the first report of GaJV-1 in Brazil, a virus that was recently described in Italy and Spain (Chiapello et al, 2020). Our results also demonstrated the graft-transmissible nature of the virus but it is unclear if GaJV-1 is associated to grapevine plant cells or strictly to a possible grapevine fungal endophyte. Additional studies on the GaJV-1 prevalence in commercial vineyards in Brazil and possible effects of the virus on grapevines are necessary. References: Chiapello, M., et al. 2020. Annals of Applied Biology 176:180. https://doi.org/10.1111/aab.12563 Fuchs, M. 2020. J. Plant Pathol. https://doi.org/10.1007/s42161-020-00579-2 Matsumura, E.E., et al. 2017. Viruses 9:92. https://doi.org/10.3390/v9040092 Silva, J.M.F., et al. 2017. Virus Genes 53:667. https://doi.org/10.1007/s11262-017-1470-y Valverde, R.A., et al. 1990. Plant Dis. 74:255. https://www.apsnet.org/publications/plantdisease/backissues/Documents/1990Articles/PlantDisease74n03_255.PDF

Understanding the molecular evolution and diversity changes of begomoviruses is crucial for predicting future outbreaks of the begomovirus disease in tomato crops. Thus, a molecular diversity study using high-throughput sequencing (HTS) was carried out on samples of infected tomato leaves collected between 2003 and 2016 from Central Brazil. DNA samples were subjected to rolling circle amplification and pooled in three batches,

No abstract