LNCaP prostate tumor cells contain an abnormal androgen receptor system. Progestagens, estradiol and anti-androgens can compete with androgens for binding to the androgen receptor and can stimulate both cell growth and excretion of prostate specific acid phosphatase. We have discovered in the LNCaP androgen receptor a single point mutation changing the sense of codon 868 (Thr to Ala) in the ligand binding domain. Expression vectors containing the normal or mutated androgen receptor sequence were transfected into COS or Hela cells. Androgens, progestagens, estrogens and anti-androgens bind the mutated androgen receptor protein and activate the expression of an androgen-regulated reporter gene construct (GRE-tk-CAT). The mutation therefore influences both binding and the induction of gene expression by different steroids and antisteroids.

No abstract

A series of human androgen receptor (AR) deletion mutants was constructed to study the relationship between the structural domains and their different functions in the AR protein. Human AR mutants were expressed in COS-1 and HeLa cells to investigate hormone binding, transcriptional activation, and subcellular localization. The wild-type human AR (AR 1-910) was expressed as a 110- to 112-kDa doublet, as revealed on immunoblots. All mutant AR proteins also migrated as doublets, except for one. This AR has a deletion from amino acid residues 51-211 and migrated as a single protein band, possibly due to altered posttranslational modification. The AR steroid-binding domain is encoded by approximately 250 amino acid residues in the C-terminal end. Deletions in this domain as well as truncation of the last 12 C-terminal amino acid residues abolished hormone binding. Cotransfection studies in HeLa cells showed that transcriptional activation of an androgen-regulated reporter gene construct was induced by the wild-type human AR. Mutational analysis revealed two regions in the N-terminal part, encoded by amino acid residues 51-211 and 244-360, to be essential for this transcriptional activation. Deletion of the hormone-binding domain yielded a constitutively active AR protein, indicating that in the absence of hormone this domain displays an inhibitory function. In the presence of its ligand, the wild-type AR was located in the cell nucleus. In the absence of androgens the receptor was mainly nuclear, but cytoplasmic localization was observed as well.(ABSTRACT TRUNCATED AT 250 WORDS)

No abstract

To locate in detail the regions in the human androgen receptor (AR) involved in transcription activation, a series of N-terminal deletions was introduced in the wild type AR and in a constitutively active AR. The different constructs were tested for their capacity to activate transcription. Almost the entire N-terminal domain (residues 1-485) was necessary for full wild type AR activity when cotransfected with the (GRE)2tkCAT reporter in HeLa cells. In contrast, a smaller part of the N-terminal domain (amino acids 360-528) was sufficient for the constitutively active AR to induce transcription of the same (GRE)2tkCAT reporter in HeLa cells. This demonstrates the capacity of the AR to use different regions in the N-terminal domain as transcription activation units (TAUs). To obtain additional information of AR N-terminal TAUs, the GAL4 DNA binding domain was linked to either the entire or parts of the AR N-terminal domain and cotransfected with the (UAS)2tkCAT reporter in HeLa cells. The results confirmed that the first 485 amino acid residues accommodate a transcription activation function. When the chimeric AR-GAL4 constructs were tested on a different reporter ((UAS)5E1bCAT), a small shift in position of the TAU, responsible for full transcription activation, was observed. The data presented show that the size and location of the active TAU in the human AR is variable, being dependent on the promoter context and the presence or absence of the ligand binding domain.

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity.

Prostate cancer (PCa) is the most frequent male malignancy and the second most common cause of cancer-related death in Western countries. Current clinical and pathological methods are limited in the prediction of postoperative outcome. It is becoming increasingly evident that small non-coding RNA (ncRNA) species are associated with the development and progression of this malignancy. To assess the diversity and abundance of small ncRNAs in PCa, we analyzed the composition of the entire small transcriptome by Illumina/ Solexa deep sequencing. We further analyzed the micro-RNA (miRNA) expression signatures of 102 fresh-frozen patient samples during PCa progression by miRNA microarrays. Both platforms were cross-validated by quantitative reverse transcriptase-PCR. Besides the altered expression of several miRNAs, our deep sequencing analyses revealed strong differential expression of small nucleolar RNAs (snoRNAs) and transfer RNAs (tRNAs). From microarray analysis, we derived a miRNA diagnostic classifier that accurately distinguishes normal from cancer samples. Furthermore, we were able to construct a PCa prognostic predictor that independently forecasts postoperative outcome. Importantly, the majority of miRNAs included in the predictor also exhibit high sequence counts and concordant differential expression in Illumina PCa samples, supported by quantitative reverse transcriptase-PCR. Our findings provide miRNA expression signatures that may serve as an accurate tool for the diagnosis and prognosis of PCa.

Expression of prostate-specific antigen (PA) mRNA was tested at various time periods after incubation of the human prostate tumor cell line LNCaP with the synthetic androgen R1881. Androgen-stimulated expression was observed within 6 h after addition of R1881 to the cells. Run-on experiments with nuclei isolated from LNCaP cells showed that expression of the PA gene could be regulated by R1881 on the level of transcription. DNase I footprints of the promoter region of the PA gene (-320 to +12) with nuclear protein extracts from LNCaP cells showed at least four protected regions. The protected areas include the TATA-box, a GC-box sequence, and a sequence AGAACAgcaAGTGCT at position -170 to -156, which closely resembles the reverse complement of the consensus sequence GGTACAnnnTGTTCT for binding of the glucocorticoid receptor and the progesterone receptor. Fragments of the PA promoter region were cloned in front of the chloramphenicol acetyltransferase (CAT) reporter gene and cotransfected with an androgen receptor expression plasmid into COS cells in a transient expression assay. CAT activity of COS cells grown in the presence of 1 nM R1881 was compared to untreated controls. A 110-fold induction of CAT activity was found if a -1600 to +12 PA promoter fragment was used in the construct. By further deletion mapping of the PA promoter a minimal region (-320 to -155) was identified as being essential for androgen-regulated gene expression. Mutation of the sequence AGAACAgcaAGTGCT (at -170 to -156) to AAAAAAgcaAGTGCT almost completely abolished androgen inducibility of the reporter gene constructs. One or more copies of the sequence AGAACAgcaAGTGCT cloned in front of a thymidine kinase promoter-CAT reporter gene confers androgen regulation to the reporter gene. These findings provide strong evidence for transcription regulation of the PA gene by androgens via the sequence AGAACAgcaAGTGCT. Interestingly, in addition to the AGAACAgcaAGTGCT element, an upstream region (-539 to -320) is needed for optimal androgen inducibility of the PA promoter.