Abstract-In the present study, we examined the expression of regulators of bone formation and osteoclastogenesis in human atherosclerosis because accumulating evidence suggests that atherosclerotic calcification shares features with bone calcification. The most striking finding of this study was the constitutive immunoreactivity of matrix Gla protein, osteocalcin, and bone sialoprotein in nondiseased aortas and the absence of bone morphogenetic protein (BMP)-2, BMP-4, osteopontin, and osteonectin in nondiseased aortas and early atherosclerotic lesions. When atherosclerotic plaques demonstrated calcification or bone formation, BMP-2, BMP-4, osteopontin, and osteonectin were upregulated. Interestingly, this upregulation was associated with a sustained immunoreactivity of matrix Gla protein, osteocalcin, and bone sialoprotein. The 2 modulators of osteoclastogenesis (osteoprotegerin [OPG] and its ligand, OPGL) were present in the nondiseased vessel wall and in early atherosclerotic lesions. In advanced calcified lesions, OPG was present in bone structures, whereas OPGL was only present in the extracellular matrix surrounding calcium deposits. The observed expression patterns suggest a tight regulation of the expression of bone matrix regulatory proteins during human atherogenesis. The expression pattern of both OPG and OPGL during atherogenesis might suggest a regulatory role of these proteins not only in osteoclastogenesis but also in atherosclerotic calcification. (Arterioscler Thromb Vasc Biol.

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity.

Extracellular matrix (ECM) remodeling is one of the underlying mechanisms in cardiovascular diseases. Cathepsin cysteine proteases have a central role in ECM remodeling and have been implicated in the development and progression of cardiovascular diseases. Cathepsins also show differential expression in various stages of atherosclerosis, and in vivo knockout studies revealed that deficiency of cathepsin K or S reduces atherosclerosis. Furthermore, cathepsins are involved in lipid metabolism. Cathepsins have the capability to degrade low-density lipoprotein and reduce cholesterol efflux from macrophages, aggravating foam cell formation. Although expression studies also demonstrated differential expression of cathepsins in cardiovascular diseases like aneurysm formation, neointima formation, and neovascularization, in vivo studies to define the exact role of cathepsins in these processes are lacking. Evaluation of the feasibility of cathepsins as a diagnostic tool revealed that serum levels of cathepsins L and S seem to be promising as biomarkers in the diagnosis of atherosclerosis, whereas cathepsin B shows potential as an imaging tool. Furthermore, cathepsin K and S inhibitors showed effectiveness in (pre) clinical evaluation for the treatment of osteoporosis and osteoarthritis, suggesting that cathepsin inhibitors may also have therapeutic effects for the treatment of atherosclerosis.

In the present study, we investigated the role of the CD40L-CD40 pathway in a model of progressive atherosclerosis. ApoE؊͞؊ mice were treated with an anti-CD40L antibody or a control antibody for 12 wk. Antibody treatment started early (age 5 wk) or was delayed until after the establishment of atherosclerosis (age 17 wk). In both the early and delayed treatment groups, anti-CD40L antibody did not decrease plaque area or inhibit lesion initiation or age-related increase in lesion area. The morphology of initial lesions was not affected, except for a decrease in T-lymphocyte content. Effects of anti-CD40L antibody treatment on the morphology of advanced lesions were pronounced. In both the early and delayed treatment groups, T-lymphocyte content was significantly decreased. Furthermore, a pronounced increase in collagen content, vascular smooth muscle cell͞myofibroblast content, and fibrous cap thickness was observed. In the delayed treatment group, a decrease in lipid core and macrophage content occurred. Interestingly, advanced lesions of anti-CD40L antibody-treated mice exhibited an increased transforming growth factor ␤1 immunoreactivity, especially in macrophages. In conclusion, both early and delayed treatment with an anti-CD40L antibody do not affect atherosclerotic lesion initiation but do result in the development of a lipid-poor collagen-rich stable plaque phenotype. Furthermore, delayed treatment with anti-CD40L antibody can transform the lesion profile from a lipid-rich to a lipid-poor collagen-rich phenotype. Postulated mechanisms of this effect on plaque phenotype are the down-regulation of proinflammatory pathways and up-regulation of collagen-promoting factors like transforming growth factor ␤.

Background-Cathepsin K (catK), a lysosomal cysteine protease, was identified in a gene-profiling experiment that compared human early plaques, advanced stable plaques, and advanced atherosclerotic plaques containing a thrombus, where it was highly upregulated in advanced stable plaques. Methods and Results-To assess the function of catK in atherosclerosis, catK Ϫ/Ϫ /apolipoprotein (apo) E Ϫ/Ϫ mice were generated. At 26 weeks of age, plaque area in the catK Ϫ/Ϫ /apoE Ϫ/Ϫ mice was reduced (41.8%) owing to a decrease in the number of advanced lesions as well as a decrease in individual advanced plaque area. This suggests an important role for catK in atherosclerosis progression. Advanced plaques of catK Ϫ/Ϫ /apoE Ϫ/Ϫ mice showed an increase in collagen content. Medial elastin fibers were less prone to rupture than those of apoE Ϫ/Ϫ mice. Although the relative macrophage content did not differ, individual macrophage size increased. In vitro studies of bone marrow derived-macrophages confirmed this observation. Scavenger receptor-mediated uptake (particularly by CD36) of modified LDL increased in the absence of catK, resulting in an increased macrophage size because of increased cellular storage of cholesterol esters, thereby enlarging the lysosomes.

No abstract

The PTEN tumor suppressor gene is frequently inactivated in human tumors, including prostate cancer. Based on the Cre/ loxP system, we generated a novel mouse prostate cancer model by targeted inactivation of the Pten gene. In this model, Cre recombinase was expressed under the control of the prostate-specific antigen (PSA) promoter. Conditional biallelic and monoallelic Pten knock-out mice were viable and Pten recombination was prostate-specific. Mouse cohorts were systematically characterized at 4 to 5, 7 to 9, and 10 to 14 months. A slightly increased proliferation rate of epithelial cells was observed in all prostate lobes of monoallelic Pten knock-out mice (PSA-Cre;Pten-loxP/+), but minimal pathologic changes were detected. All homozygous knock-out mice (PSACre;Pten-loxP/loxP) showed an increased size of the luminal epithelial cells, large areas of hyperplasia, focal prostate intraepithelial neoplasia lesions and an increased prostate weight at 4 to 5 months. More extensive prostate intraepithelial neoplasia and focal microinvasion occurred at 7 to 9 months; invasive prostate carcinoma was detected in all male PSA-Cre;Pten-loxP/loxP mice at 10 to 14 months. At 15 to 16 months, a rare lymph node metastasis was found. In hyperplastic cells and in tumor cells, the expression of phospho-AKT was up-regulated. In hyperplastic and tumor cells, expression of luminal epithelial cell cytokeratins was upregulated; tumor cells were negative for basal epithelial cell cytokeratins. Androgen receptor expression remained detectable at all stages of tumor development. The up-regulation of phospho-AKT correlated with an increased proliferation rate of the epithelial cells, but not with a reduced apoptosis.

Prostate-specific antigen (PSA) is expressed at a high level in the luminal epithelial cells of the prostate and is absent or expressed at very low levels in other tissues. PSA expression can be regulated by androgens. Previously, two functional androgen-response elements were identified in the proximal promoter of the PSA gene. To detect additional, more distal control elements, DNasel-hypersensitive sites (DHSs) upstream of the PSA gene were mapped in chromatin from the prostate-derived cell line LNCaP grown in the presence and absence of the synthetic androgen R1881. In a region 4.8 to 3.8 kb upstream of the transcription start site of the PSA gene, a cluster of three DHSs was detected. The middle DNAseI-hypersensitive site (DHSII, at approximately -4.2 kb) showed strong androgen responsiveness in LNCaP cells and was absent in chromatin from HeLa cells. Further analysis of the region encompassing DHSII provided evidence for the presence of a complex, androgen-responsive and cell-specific enhancer. In transient transfected LNCaP cells, PSA promoter constructs containing this upstream enhancer region showed approximately 3000-fold higher activity in the presence than in the absence of R1881. The core region of the enhancer could be mapped within a 440-bp fragment. The enhancer showed synergistic cooperation with the proximal PSA promoter and was found to be composed of at least three separate regulatory regions. In the center, a functionally active, high-affinity androgen receptor binding site (GGAACATATTGTATC) could be identified. Mutation of this element almost completely abolished PSA promoter activity. Transfection experiments in prostate and nonprostate cell lines showed largely LNCaP cell specificity of the upstream enhancer region, although some activity was found in the T47D mammary tumor cell line.