Aims. We investigate the detection of Cool Cores (CCs) in the distant galaxy cluster population with the purpose of measuring the CC fraction out to redshift 0.7 ≤ z < 1.4. Using a sample of nearby clusters spanning a wide range of morphologies, we define criteria to characterize cool cores, which are applicable to the high-redshift sample. Methods. We analyzed azimuthally-averaged surface brightness (SB) profiles with the known scaling relations, and we fitted single/double β models to the data. Additionally, we measured a surface brightness concentration, c SB , as the ratio of the peak over the ambient SB. To verify that this is an unbiased parameter as a function of redshift, we developed a model independent "cloning" technique to simulate the nearby clusters as they would appear at the same redshifts and luminosities as those in the distant sample. This method is based on the application of the cosmological surface brightness dimming to high-resolution Chandra images, assuming no intrinsic cluster evolution. We obtained a more physical parameterization of the CC presence by computing the cooling time at a radius of 20 kpc from the cluster center. Results. The distribution of the SB concentration and the stacked radial profiles of the low-z sample, combined with published information on the CC properties of these clusters, show 3 degrees of SB cuspiness: non-CC, moderate, and strong CC. The same analysis applied to the high-z clusters reveals two regimes: non-CC and moderate CC. The cooling time distribution corroborates this result by showing a strong negative correlation with c SB . Conclusions. Our analysis indicates a significant fraction of distant clusters harboring a moderate CC out to z = 1.4, similar to those found in the local sample. The absence of strong cooling is likely linked with a higher merger rate expected at redshift z > 0.7, and should also be related to the shorter age of distant clusters, implying less time to develop a cool core.

We present APEX LABOCA 870 μm observations of the field around the high-redshift radio galaxy MRC1138−262 at z = 2.16. We detect 16 submillimeter galaxies (SMGs) in this ∼140 arcmin 2 bolometer map with flux densities in the range 3-11 mJy. The raw number counts indicate a density of SMGs that is up to four times that of blank field surveys. Based on an exquisite multiwavelength database, including VLA 1.4 GHz radio and infrared observations, we investigate whether these sources are members of the protocluster structure at z ≈ 2.2. Using Herschel PACS and SPIRE and Spitzer MIPS photometry, we derive reliable far-infrared (FIR) photometric redshifts for all sources. Follow-up VLT ISAAC and SINFONI NIR spectra confirm that four of these SMGs have redshifts of z ≈ 2.2. We also present evidence that another SMG in this field, detected earlier at 850 μm, has a counterpart that exhibits Hα and CO(1-0) emission at z = 2.15. Including the radio galaxy and two SMGs with FIR photometric redshifts at z = 2.2, we conclude that at least eight submm sources are part of the protocluster at z = 2.16 associated with the radio galaxy MRC1138−262. We measure a star formation rate density SFRD ∼1500 M yr −1 Mpc −3 , four magnitudes higher than the global SFRD of blank fields at this redshift. Strikingly, these eight sources are concentrated within a region of 2 Mpc (the typical size of clusters in the local universe) and are distributed within the filaments traced by the HAEs at z ≈ 2.2. This concentration of massive, dusty starbursts is not centered on the submillimeter-bright radio galaxy which could support the infalling of these sources into the cluster center. Approximately half (6/11) of the SMGs that are covered by the Hα imaging data are associated with HAEs, demonstrating the potential of tracing SMG counterparts with this population. To summarize, our results demonstrate that submillimeter observations may enable us to study (proto)clusters of massive, dusty starbursts.

Context. The galaxy cluster XMMU J2235.3−2557 (hereafter XMM2235), spectroscopically confirmed at z = 1.39, is one of the most distant X-ray selected galaxy clusters. It has been at the center of a multi-wavelength observing campaign with ground and space facilities. Aims. We characterize the galaxy populations of passive members, the thermodynamical properties and metal abundance of the hot gas, and the total mass of the system using imaging data with HST/ACS (i 775 and z 850 bands) and VLT/ISAAC (J and K S bands), extensive spectroscopic data obtained with VLT/FORS2, and deep (196 ks) Chandra observations. Methods. Chandra data allow temperature and metallicity to be measured with good accuracy and the X-ray surface brightness profile to be traced out to 1 (or 500 kpc), thus allowing the mass to be reliably estimated. Out of a total sample of 34 spectroscopically confirmed cluster members, we selected 16 passive galaxies (without detectable [OII]) within the central 2 (or 1 Mpc) with ACS coverage, and inferred star formation histories for subsamples of galaxies inside and outside the core by modeling their spectrophotometric data with spectral synthesis models. Results. Chandra data show a regular elongated morphology, closely resembling the distribution of core galaxies, with a significant cool core. We measure a global X-ray temperature of kT = 8.6 +1.3 −1.2 keV (68% confidence), which we find to be robust against several systematics involved in the X-ray spectral analysis. By detecting the rest frame 6.7 keV Iron K line in the Chandra spectrum, we measure a metallicity Z = 0.26 +0.20 −0.16 Z . In the likely hypothesis of hydrostatic equilibrium, we obtain a total mass of M tot (< 1 Mpc) = (5.9 ± 1.3) × 10 14 M . By modeling both the composite spectral energy distributions and spectra of the passive galaxies in and outside the core, we find a strong mean age radial gradient. Core galaxies, with stellar masses in excess of 10 11 M , appear to have formed at an earlier epoch with a relatively short star formation phase (z = 5−6), whereas passive galaxies outside the core show spectral signatures suggesting a prolonged star formation phase to redshifts as low as z ≈ 2. Conclusions. Overall, our analysis implies that XMM2235 is the hottest and most massive bona-fide cluster discovered to date at z > 1, with a baryonic content, both its galaxy population and intracluster gas, in a significantly advanced evolutionary stage at 1/3 of the current age of the Universe.

Context. Cool-core clusters are characterized by strong surface brightness peaks in the X-ray emission from the Intra Cluster Medium (ICM). This phenomenon is associated with complex physics in the ICM and has been a subject of intense debate and investigation in recent years. The evolution of cool-cores is still poorly constrained because of the small sample statistics and the observational challenge of analysing high redshift clusters. Aims. In order to quantify the evolution in the cool-core cluster population, we robustly measure the cool-core strength in a local, representative cluster sample, and in the largest sample of high-redshift clusters available to date. Methods. We use high-resolution Chandra data of three representative cluster samples spanning different redshift ranges: (i) the low redshift sample from the 400 Square degree (SD) survey with median z = 0.08; (ii) the high redshift sample from the 400 SD Survey with median z = 0.59; and (iii) 15 clusters drawn from the Rosat Distant Cluster Survey and the Wide Angle Rosat Pointed Survey, with median z = 0.83. Our analysis is based on the measurement of the surface brightness concentration, c SB (Santos et al. 2008, A&A, 483, 35), which allows us to characterize the cool-core strength in low signal-to-noise data. We also obtain gas density profiles to derive cluster central cooling times and entropy. In addition to the X-ray analysis, we search for radio counterparts associated with the cluster cores. Results. We find a statistically significant difference in the c SB distributions of the two high-z samples, pointing towards a lack of concentrated clusters in the 400 SD high-z sample. Taking this into account, we confirm a negative evolution in the fraction of coolcore clusters with redshift, in particular for very strong cool-cores. This result is validated by the central entropy and central cooling time, which show strong anti-correlations with c SB . However, the amount of evolution is significantly smaller than previously claimed, leaving room for a large population of well formed cool-cores at z ∼ 1. Finally, we explore the potential of the proposed X-ray mission Wide Field X-ray Telescope to detect and quantify cool-cores up to z = 1.5.

We present the largest sample of spectroscopically confirmed X-ray luminous high-redshift galaxy clusters to date comprising 22 systems in the range 0.9 < z < ∼ 1.6 as part of the XMM-Newton Distant Cluster Project (XDCP). All systems were initially selected as extended X-ray sources over 76.1 deg 2 of non-contiguous deep archival XMM-Newton coverage, of which 49.4 deg 2 are part of the core survey with a quantifiable selection function and 17.7 deg 2 are classified as 'gold' coverage as starting point for upcoming cosmological applications. Distant cluster candidates were followed-up with moderately deep optical and near-infrared imaging in at least two bands to photometrically identify the cluster galaxy populations and obtain redshift estimates based on colors of simple stellar population models. We test and calibrate the most promising redshift estimation techniques based on the R−z and z−H colors for efficient distant cluster identifications and find a good redshift accuracy performance of the z−H color out to at least z∼1.5, while the redshift evolution of the R−z color leads to increasingly large uncertainties at z > ∼ 0.9. Photometrically identified high-z systems are spectroscopically confirmed with VLT/FORS 2 with a minimum of three concordant cluster member redshifts. We present first details of two newly identified clusters, ‡ Based on observations under program IDs 079.A-0634 and 085.A-0647 collected at the European Organisation for Astronomical Research in the Southern Hemisphere, Chile, and observations collected at the Centro Astronómico Hispano Alemán (CAHA) at Calar Alto, operated jointly by the Max-Planck Institut für Astronomie and the Instituto de Astrofísica de Andalucía (CSIC).§ Visiting astronomer at MPE.The X-ray luminous galaxy cluster population at 0.9 < z ≤ 1.6 as revealed by the XDCP 2 XDCP J0338.5+0029 at z=0.916 and XDCP J0027.2+1714 at z=0.959, and investigate the Xray properties of SpARCS J003550-431224 at z=1.335, which shows evidence for ongoing major merger activity along the line-of-sight. We provide X-ray properties and luminositybased total mass estimates for the full sample of 22 high-z clusters, of which 17 are at z ≥ 1.0 and 7 populate the highest redshift bin at z > 1.3. The median system mass of the sample is M 200 ≃ 2 × 10 14 M ⊙ , while the probed mass range for the distant clusters spans approximately (0.7-7)×10 14 M ⊙ . The majority (>70%) of the X-ray selected clusters show rather regular Xray morphologies, albeit in most cases with a discernible elongation along one axis. In contrast to local clusters, the z > 0.9 systems do mostly not harbor central dominant galaxies coincident with the X-ray centroid position, but rather exhibit significant BCG offsets from the X-ray center with a median value of about 50 kpc in projection and a smaller median luminosity gap to the second-ranked galaxy of ∆m 12 ≃ 0.3 mag. We estimate a fraction of cluster-associated NVSS 1.4 GHz radio sources of about 30%, preferentially located within 1 ′ from the X-ray center. This value sugge...

We present a multi-wavelength study of galaxy populations in the core of the massive, X-ray luminous cluster XMMU J2235 at z = 1.39, based on high quality VLT and HST photometry at optical and near-infrared wavelengths. We derive luminosity functions in the z, H, and K s bands, approximately corresponding to restframe U, R and z band. These show a faint-end slope consistent with being flat, and a characteristic magnitude M * close to passive evolution predictions of M * of local massive clusters, with a formation redshift z > 2. The color−magnitude and color-mass diagrams show evidence of a tight red sequence (intrinsic scatter < ∼ 0.08) of massive galaxies already in place, with overall old stellar populations and generally early-type morphology. Beside the red colors, these massive (>6 × 10 10 M ) galaxies typically show early-type spectral features, and rest-frame far-UV emission consistent with very low star formation rates (SFR < 0.2 M yr −1 ). Star forming spectroscopic members, with SFR of up to ∼100 M /yr, are all located at clustercentric distances > ∼ 250 kpc, with the central cluster region already appearing effectively quenched. Most part of the cluster galaxies more massive than 6 × 10 10 M within the studied area do not appear to host significant levels of star formation. The high-mass end of the galaxy populations in the core of this cluster appears to be in a very advanced evolutionary stage, not only in terms of formation of the stellar populations, but also of the assembly of the stellar mass. The high-mass end of the galaxy stellar mass function is essentially already in place. The stellar mass fraction estimated within r 500 (∼1%, Kroupa IMF) is already similar to that of local massive clusters. On the other hand, surface brightness distribution modeling of the massive red sequence galaxies may suggest that their size is often smaller than expected based on the local stellar mass vs. size relation. An evolution of the stellar mass vs. size relation might imply that, in spite of the overall early assembly of these sources, their evolution is not complete, and processes like minor (and likely dry) merging might still shape the structural properties of these objects to resemble those of their local counterparts, without substantially affecting their stellar mass or host stellar populations. Nonetheless, a definite conclusion on the actual relevance of size evolution for the studied early-type sample is precluded by possible systematics and biases.

We report on the discovery of a very distant galaxy cluster serendipitously detected in the archive of the XMM-Newton mission, within the scope of the XMM-Newton Distant Cluster Project (XDCP). XMMUJ0044.0-2033 was detected at a high significance level (5σ) as a compact, but significantly extended source in the X-ray data, with a soft-band flux f (r < 40 ) = (1.5 ± 0.3) × 10 −14 erg s −1 cm 2 . Optical/NIR follow-up observations confirmed the presence of an overdensity of red galaxies matching the X-ray emission. The cluster was spectroscopically confirmed to be at z = 1.579 using ground-based VLT/FORS2 spectroscopy. The analysis of the I−H colour−magnitude diagram shows a sequence of red galaxies with a colour range [3.7 < I−H < 4.6] within 1 from the cluster X-ray emission peak. However, the three spectroscopic members (all with complex morphology) have significantly bluer colours relative to the observed red-sequence. In addition, two of the three cluster members have [OII] emission, indicative of on-going star formation. Using the spectroscopic redshift we estimated the X-ray bolometric luminosity, L bol,40 ∼ 5.8 × 10 44 erg s −1 , implying a massive galaxy cluster. This places XMMU J0044.0-2033 at the forefront of massive distant clusters, closing the gap between lower redshift systems and recently discovered proto-and low-mass clusters at z > 1.6.

DEVELOPMENT 800 material). The meis3-MO, which has nine and seven mismatches with meis1 and meis2.2, respectively, also served as control MO in some experiments. Eye phenotype measurementsThe polygonal-lasso tool from Adobe Photoshop was used to measure in digital photographs taken with the same magnification, the eye surface area (in pixels) of control and morphant embryos. The volume of each eye was estimated considering it as a hemisphere of radius equal to the radius of a circle with that same area. Measurements from 20 eyes for each condition were compared using a 2 test. Plasmid constructsI.M.A.G.E. cDNA clones, from the Lawrence Livermore National Laboratory Consortium, used were: ccnd1 (IMAGE IRALp962K2356Q), cmyc (IRBOp991F125D), meis1 (IRAKp961C08136Q), meis2.1 (IRBOp991C0733D), meis2.2 (IRBOp991D0437D), meis3 (IRALp962E1456Q) and meis4 (MPMGp609N1326Q). pCS2-ccnd1 was generated by inserting the full-length cDNA into EcoRI and XbaI sites of pCS2+. To generate GFP-meis1, MT-meis1, meis1-MT, MT-meis2.2, meis2.2-MT, MT-meis3, meis3-MT, MT-meis4 and meis4-MT constructs, we PCR amplified the corresponding Meis coding regions with the following primer pairs (5Ј-3Ј; EcoRI and XhoI sites underlined): GAATTCGATGGCGCAGAGGT and CTCGAGCATGTAGTGCCAC -TGTCCC for meis1; GAATTCGATGGCGCAAAGGTACGA and CTCGAGCATGTAGTGCCACTGGCC for meis2.2; GAATTCCATG -GATA AGAGGTATGAGGAGTT and CTCGAGGTGGGCATGTA -TGTCAA for meis3; and GAATTCCATGGCGCAACGGTACGA and CTCGAGCATGTAGTGCCACTGACTCTC for meis4.The PCR fragments were subcloned into pGEMT-Easy (Promega) and sequenced. Meis cDNAs were cloned into pCS2 MT, pCS2p+MTC2 or pCS2eGFP (kindly provided by D. Turner, University of Michigan, USA) to generate N-terminal (Myc-meis) and C-terminal (meis-Myc) Myc-tagged meis or N-terminal GFP-tagged meis1 (GFP-meis1), respectively. To generate the Tol2-GFP-meis1 and Tol2-GFP constructs, we inserted the GFP-meis1 and GFP fragments, respectively, into SalI and SspI sites of Tol2 (pT2KXIG). Acridine Orange stainingAcridine Orange staining was performed as described (Perkins et al., 2005). DNA content analysis and flow cytometryEyes dissected from 19hpf zebrafish embryos were disaggregated, and PI staining carried out as described (Langenau et al., 2003). DNA content was analyzed on a BD FACSAria and results processed with FloJo software (Tree Star). A 2 test was used for statistical data analysis. Induction of ectopic expression mosaicsThe Tol2 transposon/transposase method of transgenesis (Kawakami et al., 2004) was used with minor modifications. Four-to 16-cell-stage zebrafish embryos were injected in the yolk with 5-12.5 pg of either Tol2-GFP-meis1 or Tol2-GFP constructs, plus 125 pg of transposase-encoding mRNA in a final volume of 5 nl of injection solution. Embryos were cultured at 28.5°C, staged and fixed. Anti-GFP antibody was used to detect the GFP-or GFP-meis1-expressing clones. A stack of confocal zsections was obtained for each eye analyzed. Three-dimensional reconstruction of the stacks was used to determine the location of the clones. e...