meis1regulatescyclin D1andc-mycexpression, and controls the proliferation of the multipotent cells in the early developing zebrafish eye

Abstract

DEVELOPMENT 800 material). The meis3-MO, which has nine and seven mismatches with meis1 and meis2.2, respectively, also served as control MO in some experiments. Eye phenotype measurementsThe polygonal-lasso tool from Adobe Photoshop was used to measure in digital photographs taken with the same magnification, the eye surface area (in pixels) of control and morphant embryos. The volume of each eye was estimated considering it as a hemisphere of radius equal to the radius of a circle with that same area. Measurements from 20 eyes for each condition were compared using a 2 test. Plasmid constructsI.M.A.G.E. cDNA clones, from the Lawrence Livermore National Laboratory Consortium, used were: ccnd1 (IMAGE IRALp962K2356Q), cmyc (IRBOp991F125D), meis1 (IRAKp961C08136Q), meis2.1 (IRBOp991C0733D), meis2.2 (IRBOp991D0437D), meis3 (IRALp962E1456Q) and meis4 (MPMGp609N1326Q). pCS2-ccnd1 was generated by inserting the full-length cDNA into EcoRI and XbaI sites of pCS2+. To generate GFP-meis1, MT-meis1, meis1-MT, MT-meis2.2, meis2.2-MT, MT-meis3, meis3-MT, MT-meis4 and meis4-MT constructs, we PCR amplified the corresponding Meis coding regions with the following primer pairs (5Ј-3Ј; EcoRI and XhoI sites underlined): GAATTCGATGGCGCAGAGGT and CTCGAGCATGTAGTGCCAC -TGTCCC for meis1; GAATTCGATGGCGCAAAGGTACGA and CTCGAGCATGTAGTGCCACTGGCC for meis2.2; GAATTCCATG -GATA AGAGGTATGAGGAGTT and CTCGAGGTGGGCATGTA -TGTCAA for meis3; and GAATTCCATGGCGCAACGGTACGA and CTCGAGCATGTAGTGCCACTGACTCTC for meis4.The PCR fragments were subcloned into pGEMT-Easy (Promega) and sequenced. Meis cDNAs were cloned into pCS2 MT, pCS2p+MTC2 or pCS2eGFP (kindly provided by D. Turner, University of Michigan, USA) to generate N-terminal (Myc-meis) and C-terminal (meis-Myc) Myc-tagged meis or N-terminal GFP-tagged meis1 (GFP-meis1), respectively. To generate the Tol2-GFP-meis1 and Tol2-GFP constructs, we inserted the GFP-meis1 and GFP fragments, respectively, into SalI and SspI sites of Tol2 (pT2KXIG). Acridine Orange stainingAcridine Orange staining was performed as described (Perkins et al., 2005). DNA content analysis and flow cytometryEyes dissected from 19hpf zebrafish embryos were disaggregated, and PI staining carried out as described (Langenau et al., 2003). DNA content was analyzed on a BD FACSAria and results processed with FloJo software (Tree Star). A 2 test was used for statistical data analysis. Induction of ectopic expression mosaicsThe Tol2 transposon/transposase method of transgenesis (Kawakami et al., 2004) was used with minor modifications. Four-to 16-cell-stage zebrafish embryos were injected in the yolk with 5-12.5 pg of either Tol2-GFP-meis1 or Tol2-GFP constructs, plus 125 pg of transposase-encoding mRNA in a final volume of 5 nl of injection solution. Embryos were cultured at 28.5°C, staged and fixed. Anti-GFP antibody was used to detect the GFP-or GFP-meis1-expressing clones. A stack of confocal zsections was obtained for each eye analyzed. Three-dimensional reconstruction of the stacks was used to determine the location of the clones. e...

miR-204 is required for lens and retinal development via Meis2 targeting

“…From St20 onward, duplex-injected embryos were severely microphthalmic, with small lenses (Fig. S2 J-L), which strongly resembled the phenotype reported for Meis2.2 zebrafish morphant embryos (19). Consistent with the hypothesis that olMeis2 is an important miR-204 target, expression of the olMeis2, olPax6, olSox2, olProx1, and olα-ACrystallin genes was significantly reduced in the lens placode of all the duplex-injected embryos (Fig.…”

“…This regulatory cascade is strongly supported by a number of observations. Meis2 directly activates Pax6 expression during lens and retina development in the zebrafish, chick, and mouse (16,19,30). In medaka fish embryos, expression levels of olMeis2 and, concomitantly, those of olPax6 and its downstream targets are up-regulated on miR-204 knock-down or inhibition of the miR-204 interaction with its specific target site in the Meis2 3′-UTR.…”

Zebrafish enhancer detection (ZED) vector: A new tool to facilitate transgenesis and the functional analysis of cis‐regulatory regions in zebrafish

“…In Vitro mRNA Synthesis, Microinjection, and Transgenesis cDNAs were linearized and mRNAs were transcribed as described (Bessa et al, 2008), and 100 -200 pg of each mRNA was injected in one-cell stage embryos. Transposase (Kawakami et al, 2004), Cre (Langenau et al, 2005), and Flipase (Werdien et al, 2001) cDNAs were linearized using NotI restriction enzyme, and mRNA was synthesized using Sp6 RNA polymerase.…”

Loss of adenomatous polyposis coli (apc) results in an expanded ciliary marginal zone in the zebrafish eye

“…cyclinD1 and myca are regulated by meis1 in the chick and zebrafish retina (Bessa et al, 2008;Heine et al, 2008). meis1 is a homeodomain transcription factor that is expressed in retinal progenitor cells in Drosophila and zebrafish and keeps them in a proliferative state and suppresses differentiation (Pai et al, 1998;Bessa et al, 2008;Heine et al, 2008).…”

“…meis1 is a homeodomain transcription factor that is expressed in retinal progenitor cells in Drosophila and zebrafish and keeps them in a proliferative state and suppresses differentiation (Pai et al, 1998;Bessa et al, 2008;Heine et al, 2008). In the absence of meis1, cyclinD1 and myca expression rates are reduced, leading to a reduction in proliferation.…”