A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.

RT-PCR for tyrosinase mRNA and S-100 are significant prognostic factors for progression-free survival and OS in melanoma. S-100 has higher sensitivity and specificity than tyrosinase.

No abstract

Summary• Purpose: The immune response is altered in patients with neoplasms. Immunosuppression has important consequences in patients with melanoma. The aim of this study was to assess quantitative immune alterations in melanoma patients..• Material and methods: We obtained a peripheral blood sample in EDTA from 86 melanoma patients (63 of them disease-free and 23 with distant disease). Total leukocytes and lymphocytes, B lymphocytes (CD19), types CD3, CD4, CD8 lymphocytes, and NK lymphocytes (CD56) were counted by determining the surface markers by flow cytometry, using a Coulter Epics Elite (Coulter Corp.). IgA, IgG, IgE and IgM were assayed by nephelometric methods employing a Hyland PDQ laser nephelometer.

with Ab42 plus adjuvant (AN1792, Elan Pharmaceuticals) or placebo were studied. Comprehensive neuropathological assessments were performed ranging from 4 months to 14 years after the trial. Large coronal paraffin sections of cerebral hemisphere were immunostained for Ab, scanned, then (i) the entire neocortical ribbon was scored for plaques in a CERAD-like manner (frequent¼3, moder-ate¼2, sparse¼1, none¼0) and (ii) false coloured to permit visualisation of staining patterns at low power. Results: 16/21 had a distribution of tangles and at least some residual Ab pathology indicating the cause of dementia had been AD, whereas 5/21 had alternative causes for dementia (PSP¼1, DLB¼1, VaD¼1and FTD-TDP43¼2). 18/21 had received the active agent and 3/21 the placebo. Scanning and false colouration of large Ab immunostained sections generated images suitable for comparison with amyloid PET scans as used in current immunotherapy trials. 13/15 AD subjects receiving the active agent had evidence of plaque removal (almost complete removal¼5, extensive patches of removal¼4, small patches of removal¼4, no plaque removal¼2). In the immunised AD group the mean plaque score was 1.46 (range¼0.05-2.9) vs. 2.4 for the single placebo AD case. There was a significant inverse correlation between peripheral blood anti-Ab titres and plaque scores. Conclusions: AD patients actively immunised against Ab can remain virtually plaque-free for up to 14 years. Nearly a quarter of the patients examined in this study did not have neuropathologically verified AD. Neuropathology follow up of patients in therapeutic trials for AD provides valuable information on the cause of dementia and effects of treatment.