Prognostic role of circulating melanoma cells detected by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA in patients with melanoma

Abstract

A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.

Circulating tumor cells in solid cancer: Tumor marker of clinical relevance?

“…As a result, some investigators have focused their attention on the prognostic value of CTC in intermediate stages (II, III), reporting positive results [37][38][39]. These findings are of particular interest, as this subset of patients urgently needs novel prognostic factors for definitely proving or confuting the efficacy of adjuvant therapy (eg, interferon-) for which no general consensus has been reached.…”

Prognostic Factors in Cutaneous Melanoma

“…In a study that screened for multiple circulating melanoma antigen markers, p97, MUC18, and Melan A, but not tyrosinase, were found to be independently associated with prognosis [ 178 ]. Moreover, other investigators have found in their databases that tyrosinase RT-PCR [ 180 , 189 , 190 , 193 ] or multimarker RT-PCR (tyrosinase, MAGE-3, MUC-18, p97) [ 179 ] constituted a signifi cant, independent prognostic marker signifying increased risk of relapse and was a signifi cant adverse prognostic factor for disease-free (but not overall) survival in another analysis [ 191 ] and an independent predictor of disease-free and overall survival in a German database [ 194 ]. Thus, detection of tyrosinase transcripts in the circulation by RT-PCR holds promise as a future standard marker for melanoma progression.…”

Targeting Melanoma with Cancer-Killing Viruses

“…Studies have shown that elevated levels of VEGF and MIA are associated with more advanced disease and poor survival rates [33, 34]. Other serum biomarkers for melanoma include tyrosinase [35], osteopontin [36], IL-8 [37] etc .…”