No abstract

Accelerated development of novel CRISPR/Cas9-based genome editing techniques provides a feasible approach to introduce a variety of precise modifications in the mammalian genome, including introduction of multiple edits simultaneously, efficient insertion of long DNA sequences into specific targeted loci as well as performing nucleotide transitions and transversions. Thus, the CRISPR/Cas9 tool has become the method of choice for introducing genome alterations in livestock species. The list of new CRISPR/Cas9-based genome editing tools is constantly expanding. Here, we discuss the methods developed to improve efficiency and specificity of gene editing tools as well as approaches that can be employed for gene regulation, base editing, and epigenetic modifications. Additionally, advantages and disadvantages of two primary methods used for the production of gene-edited farm animals: somatic cell nuclear transfer (SCNT or cloning) and zygote manipulations will be discussed. Furthermore, we will review agricultural and biomedical applications of gene editing technology.

for excellent assistance with animal care. Also, we would like to acknowledge the Epithelial Cell Core at the CWRU CF Center (Cystic Fibrosis Foundation RDP R447-CR11) and Dr. R. Bridges of Rosalind Franklin University for generous donation of SMG1-i, through the CFFT compound distribution program. We also acknowledge Amanda Wilheim and Sherry Iodice for preparation of the histology slides. This work was partially supported by US Department of Agriculture Multistate Project W-4171 (IAP) and the Utah Agricultural Experiment Station (Project 1343).

Serial cloning by somatic cell nuclear transfer (SCNT) is a critical tool for the expansion of precious transgenic lines or resetting the lifespan of primary transgenic cells for multiple genetic modifications. We successfully produced second-generation cloned goats using donor neonatal fibroblasts from first-generation clones. However, our attempts to produce any third-generation clones failed. SCNT efficiency decreased progressively with the clonal generations. The rate of pregnancy loss was significantly greater in recloning groups (P<0.05). While no pregnancy loss was observed during the first round of SCNT, 14 out of 21 pregnancies aborted in the second round of SCNT and all pregnancies aborted in the third round of SCNT. In this retrospective study, we also investigated the expression of 21 developmentally important genes in muscle tissue of cloned (G1) and recloned (G2) offspring. The expression of most of these genes in live clones was found to be largely comparable to naturally reproduced control goats, but fibroblast growth factor 10 (FGF10), methyl CpG binding protein 2 (MECP2) and growth factor receptor bound protein 10 (GRB10) were differentially expressed (P<0.05) in G2 goats compared with G1 and controls. To study the effects of serial cloning on DNA methylation, the methylation pattern of differentially methylated regions in imprinted genes H19 and insulin like growth factor 2 receptor (IGF2R) were also analysed. Aberrant H19 DNA methylation patterns were detected in G1 and G2 clones.

 RESUMOA realização do presente estudo teve como objetivo mapear Quantitative Trait Loci (QTL) de carcaça e qualidade de carne em uma população F2 de suínos desenvolvida pelo cruzamento de dois reprodutores da raça brasileira Piau com 18 fêmeas comerciais (Landrace x Large White x Pietrain). O mapa de ligação para essa população foi construído após a genotipagem de 684 animais para 35 marcadores microssatélites. Os dados foram analisados pelo mapeamento por intervalo usando-se sexo, lote e genótipo halotano como efeitos fixos e peso de carcaça ao abate, peso da carcaça direita e idade ao abate como covariáveis. Um total de 18 QTLs foi encontrado; os QTLs para maior espessura de toucinho na região da copa, na linha dorsolombar, e a perda por cozimento foram significativos em nível de 5% genômico. A característica espessura de toucinho foi essencialmente associada aos alelos da raça Piau, conhecido como porco tipo banha. As informações dos QTLs significativos encontrados servem para futuros estudos de mapeamento fino para identificação de genes a serem usados em conjunto com os métodos tradicionais de seleção, para melhorar a eficiência dos programas de melhoramento, assim como prover informação acerca da fisiologia envolvida no desenvolvimento das características quantitativas dos suínos.Palavras-chave: suínos, raça Piau, marcador molecular, microssátelites ABSTRACT The accomplishment of the present study had as objective to map Quantitative Trait Loci (QTL) associated to carcass and quality traits in a F2 pig population developed by mating two Brazilian Piau breed sires with 18 dams from a commercial line (Landrace × Large White × Pietrain

MicroRNAs are a class of naturally occurring non-coding RNAs. Typically they are $ 22 nucleotides long and suppress translation of their targets genes. Several laboratories have attempted to identify miRNAs from pig muscle and the bioinformatics strategies using ESTs have proved to be successful for this aim. In this study we report an in silico identification of ncRNA in pig EST libraries focusing on novel pig miRNAs and further investigated the differential expression of pigs miRNAs (known and novel) by quantitative real-time PCR during pre-and postnatal stage from Commercial and local breed Piau pigs skeletal muscle tissue. We identified two miRNAs not yet described in pigs: hsa-miR-1207-5p and hsa-miR-665. Besides, we found 288 target genes for hsa-miR-1207-5p and 214 for hsa-miR-665; from them, four are muscle specific genes. Through expression analyses, differences were found between pre-and postnatal stages and genetics groups. The findings of miRNAs and their muscle-specific targets in pigs will be helpful for understanding the function and processing of this RNA class in the future. Besides, the miRNAs differentially expressed between Commercial and Piau breeds suggest that they can be used to uncover phenotypic differences across different genetic groups.

The NANOS2 gene, encoding an RNA binding protein, is known to play a critical role in the development of germline for all organisms studied to date. The male mice with biallelic NANOS2 knockouts (KOs) are sterile due to apoptosis of prospermatogonia shortly after birth but with morphologically intact seminiferous tubules. Thus, the choice of NANOS2 for targeting could be a viable strategy to develop germline ablated males that would serve as recipients for exogenous spermatogonial stem cell transplantation. The goat is a potential model of human physiology and an agriculturally important species. Here, we report successful generation of NANOS2 KO goats using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. We first designed 4 single-guide RNAs (sgRNAs) specific for the single exon of goat NANOS2 (GenBank: NC_030825.1). The targeting vectors were constructed by using the pX330 plasmid (Addgene: 42230) and transfected into sheep fetal fibroblasts. Mutation efficiency analysis showed that 3 of them (out of 4, 75.0%) were efficient in directing Cas9 to generate targeted cleavages, with mutation efficiencies of 10-30%. We established single cell-derived fetal fibroblast colonies by limiting dilution of the cells transfected with one of targeting vectors (sgRNA: GCTGGAGACCCAAGGGACTG). Colony screening with PCR/restriction fragment length polymorphism (RFLP) assays confirmed that we achieved biallelic mutations in the targeting site in 6 of 89 (6.7%) male and 6 of 172 (3.5%) female colonies. Sanger sequencing analysis of genomic DNA isolated from cell colonies with biallelic mutations showed that typical nucleotide deletions and insertions (indels), caused by repairing double-strand DNA breaks during the error-prone non-homologous end joining (NHEJ) process, were generated at the targeting site of NANOS2. Three male and two female colonies with NANOS2 null mutations were identified and used as cell donors for SCNT. In total, 202 cloned 1-cell stage embryos (130 male or 72 female) were generated and surgically transferred into 12 synchronized recipients. Six of them (6 of 12, 50.0%) were confirmed pregnant by ultrasonography on Day 40-45 of gestation. Four pregnancies developed to term, resulting in six offspring (five males and one female). Sequence analysis and PCR/RFLP assays showed that both male and female offspring carried the mutations in NANOS2, which were identical to the donor colonies from which they originated. Our results indicated that CRISPR/Cas9 combined with SCNT is an efficient system for generating NANOS2 KO goats. The phenotypic analysis to assess the effects of NANOS2 KO on the development of germline in male cloned goats is in progress.

No abstract