A mutant strain, Y,, of Euglena gracilis strain Z that is unable to produce protochlorophyUl or chlorophyl has been isolated folowing treatment The light-induced formation of chloroplasts in Euglena gracilis represents de novo synthesis ofthe several enzymes of the reductive pentose-P cycle, various components of the photosynthetic electron transport chain, chloroplast pigments (Chl a and b, carotenoids), several classes of RNA and other macromolecules, DNA (29,30), and the complex molecular architecture of the mature plastid (22,26). The control mechanisms regulating light-induced plastid differentiation are poorly understood, although several lines of investigation indicate a highly organized sequence of events (13, 19,23,25,26). In an effort to understand better the regulatory mechanisms underlying chloroplast development in Euglena, we have isolated a series of mutant strains blocked at various stages of the developmental process. We report here the characteristics of Y9ZNalL, a mutant unable to synthesize Chl.
MATERIALS AND METHODSOrganism and Growth Conditions. E. gracilis var. bacillaris, strain Z, was cultured in acidic organotrophic medium (12) at 26 C. Illumination was provided by 30-w Sylvania cool-white fluorescent bulbs. The light intensity at the surface of the growth flasks was approximately 400 ft-c.
The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.