SummaryMany plants acquire freezing tolerance through cold acclimatization (CA), a prolonged exposure to low but non-freezing temperatures at the onset of winter. CA is associated with gene expression that requires transient calcium in¯ux into the cytosol. Alfalfa (Medicago sativa) cells treated with agents blocking this in¯ux are unable to cold-acclimatize. Conversely, chemical agents causing increased calcium in¯ux induce cold acclimatization-speci®c (cas) gene expression in alfalfa at 25LC. How low temperature triggers calcium in¯ux is, however, unknown. We report here that induction of a CA-speci®c gene (cas30), calcium in¯ux and freezing tolerance at 4LC are all prevented by cell membrane¯uidization, but, conversely, are induced at 25LC by membrane rigidi®cation. cas30 expression and calcium in¯ux at 4LC are also prevented by jasplakinolide (JK), an actin micro®lament stabilizer, but induced at 25LC by the actin micro®lament destabilizer cytochalasin D (CD). JK blocked the membrane rigidi®er-induced, but not the calcium channel agonist-induced cas30 expression at 25LC. These ®ndings indicate that cytoskeleton re-organization is an integral component in low-temperature signal transduction in alfalfa cell suspension cultures, serving as a link between membrane rigidi®cation and calcium in¯ux in CA.
A flax (Linum usitatissimum L.) lambda gt10 cDNA library was screened with a probe coding for the amino terminus of a flax peroxidase. The probe was generated by PCR amplification of the library with one of the lambda gt10 sequencing primers and a mixed oligonucleotide derived from a well-conserved amino acid region (distal heme ligand) found in all plant peroxidases. A positive clone (FLXPER2) was isolated and characterized. The cDNA contains 1153 nucleotides, excluding the poly(A) tail, and encodes a mature protein of 297 amino acids with a molecular mass of 31.9 kDa. The mature protein's amino acid sequence contains three highly conserved regions, two of which contain histidine ligands for the heme group. The deduced amino acid sequence has nine cysteine residues. Eight are identically located to those of horseradish C peroxidase, which participate in four disulfide bridges; these cysteines are highly conserved in all plant peroxidases. One potential N-glycosylation site (Asn-X-Thr/Ser) is present. The predicted pI value of 4.5 identifies FLXPER2 as an anionic peroxidase. Northern blot analysis shows that its mRNA expression is unique to stem tissue. Amino acid sequence comparisons show high similarity between FLXPER2 and peanut, rice, and tobacco peroxidases.
A flax (Linum usitatissimum L.) peroxidase cDNA (FLXPER1) was isolated from a �gt10 library made from RNA derived from shoot tissue of the cultivar Stormont Cirrus, by screening with probes encoding amino termini of flax peroxidases. The probes were obtained by PCR amplification of the library with the �gt10 reverse primer 5'CTTATGAGTATTTCTTCCAGGGTA3' flanking the Eco RI cloning site, and a mixed oligonucleotide derived from the catalytic domain (HFHDCFV) found in all plant peroxidases. FLXPER1 is the second flax peroxidase to be so isolated and described, following the previously documented FLXPER2 (Omann et al. 1994, Genome 37, 137-147). These two cDNAs are the completely sequenced members of a family currently encompassing FLXPER1 to FLXPER4, all isolated from the same �gt10 library. FLXPER3 and 4 will be separately described and related to FLXPER1, 2. The FLXPER1 deduced amino acid sequence reveals a signal peptide of 27 amino acids, and an anionic mature protein with seven potential N-linked glycosylation sites in its 332 amino acids (38.25 kDa; pI 4.38). The FLXPER1 C terminus is similar to plant peroxidases with a putative C-terminal vacuolar targeting signal, but also contains amino acid motifs with striking homologies to the membrane anchoring motifs of a pea blue copper type protein correlated with lignin deposition. Northern blot analysis demonstrated its stem specific expression. Southern blots suggested one to five copies of FLXPER1 in the flax genome, compared with one to two for FLXPER2. FLXPER1 resembles cucumber, poplar and tobacco amino acid sequences; its asymmetry in codon usage coincides with that of other dicotyledon peroxidases, i.e. much lower than in monocotyledon peroxidases.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.