An Anionic, Stem-Specific Flax Peroxidase cDNA With C-Terminal Motifs Also Found in a Blue Copper-Type Pea Protein Correlated With Lignin Deposition

Abstract

A flax (Linum usitatissimum L.) peroxidase cDNA (FLXPER1) was isolated from a �gt10 library made from RNA derived from shoot tissue of the cultivar Stormont Cirrus, by screening with probes encoding amino termini of flax peroxidases. The probes were obtained by PCR amplification of the library with the �gt10 reverse primer 5'CTTATGAGTATTTCTTCCAGGGTA3' flanking the Eco RI cloning site, and a mixed oligonucleotide derived from the catalytic domain (HFHDCFV) found in all plant peroxidases. FLXPER1 is the second flax peroxidase to be so isolated and described, following the previously documented FLXPER2 (Omann et al. 1994, Genome 37, 137-147). These two cDNAs are the completely sequenced members of a family currently encompassing FLXPER1 to FLXPER4, all isolated from the same �gt10 library. FLXPER3 and 4 will be separately described and related to FLXPER1, 2. The FLXPER1 deduced amino acid sequence reveals a signal peptide of 27 amino acids, and an anionic mature protein with seven potential N-linked glycosylation sites in its 332 amino acids (38.25 kDa; pI 4.38). The FLXPER1 C terminus is similar to plant peroxidases with a putative C-terminal vacuolar targeting signal, but also contains amino acid motifs with striking homologies to the membrane anchoring motifs of a pea blue copper type protein correlated with lignin deposition. Northern blot analysis demonstrated its stem specific expression. Southern blots suggested one to five copies of FLXPER1 in the flax genome, compared with one to two for FLXPER2. FLXPER1 resembles cucumber, poplar and tobacco amino acid sequences; its asymmetry in codon usage coincides with that of other dicotyledon peroxidases, i.e. much lower than in monocotyledon peroxidases.

Molecular Cloning and Tissue-Specific Expression of an Anionic Peroxidase in Zucchini1

“…Both are also present in leaves and other organs of light-grown plants (data not shown), probably indicating an essential role for this isoperoxidase. A similar wide expression was reported for some isoperoxidases (Kjaersgård et al, 1997;Teichmann et al, 1997;Klotz et al, 1998), whereas others exhibit an organ-specific expression or are synthesized only after a specific treatment (Morgens et al, 1990;Mohan et al, 1993;Rasmussen et al, 1995;Omann and Tyson, 1996). The northern analyses done in this work (Fig.…”

“…There is also a difference between the calculated pI (5.1) and the pI that was determined experimentally (4.3) (Penel and Greppin, 1994). APRX sequence analysis also showed the presence of a C-terminal propeptide that is generally supposed to target the protein toward the vacuole (Johansson et al, 1992;Neuhaus et al, 1994;Omann and Tyson, 1996). In spite of that, APRX was found at least partly in apoplastic spaces (Fig.…”

A deletion mutation at the ep locus causes low seed coat peroxidase activity in soybean

“…Although the enzyme appears to accumulate intracellularly within the hourglass cells, the exact subcellular location is not known. The carboxyterminus is homologous to that of other vacuolar targeted peroxidases (Omann and Tyson, 1996) but is distinguished from these by its high lysine content.…”

Charge and molecular weight differences for fourteen guaiacol peroxidase isozymes in flax indicate that most are encoded by different structural genes

“…Peroxidase isozymes which either directly or indirectly regulate auxin and/or ethylene levels are also of interest because stem growth and development affect fiber characteristics, such as length and yield. To date, there are two reported cDNA sequences for complete flax peroxidase genes, FLAXPER1 [3] and FLAXPER2 [4]. Both genes encode anionic polypeptides, both are expressed in stems, and for at least one (FLAXPER1) the expression appears to be stem-specific.…”