BackgroundIt is well known that nitric oxide (NO) is generated by a family of constitutively (nNOS and eNOS) or inducibly (iNOS) expressed enzymes and takes part in different aspects of the inflammatory response; nevertheless, its effective role in the pathogenesis of multiple organ dysfunction and septic shock is not fully understood.MethodsTo investigate the Nitric Oxide Synthases (NOSs) expression in endothelial cells during endotoxin exposure and the involvement of NO in lipopolysaccharide (LPS)-induced apoptosis, primary cultures of porcine Aortic Endothelial Cells (pAECs) were exposed to LPS for different time periods (1-24 h) and to LPS + L-NAME (15 h).ResultsLipopolysaccharide induced an increase in mRNA and protein iNOS expression; on the contrary, the expression of eNOS was decreased. Furthermore, NOSs localisation was in part modified by LPS treatment. No alteration in the total level of Nitric Oxide was observed. L-NAME (5 mM) addition determined a slight decrease of LPS-induced apoptosis.ConclusionsEndotoxin treatment strongly influenced NOS expression with an upregulation of iNOS and a simultaneous down regulation of eNOS. Moreover, in our model, the involvement of NO on LPS-induced apoptosis is very modest, suggesting that different pathways are involved in the regulation of this process.
Redox‐responsive silica drug delivery systems are synthesized by aeco‐friendly diatomite source to achieve on‐demand release of peptide nucleic acid (PNA) in tumor reducing microenvironment, aiming to inhibit the immune checkpoint programmed cell death 1 receptor/programmed cell death receptor ligand 1 (PD‐1/PD‐L1) in cancer cells. The nanoparticles (NPs) are coated with polyethylene glycol chains as gatekeepers to improve their physicochemical properties and control drug release through the cleavable disulfide bonds (S–S) in a reductive environment. This study describes different chemical conditions to achieve the highest NPs’ surface functionalization yield, exploring both multistep and one‐pot chemical functionalization strategies. The best formulation is used for covalent PNA conjugation via the S–S bond reaching a loading degree of 306 ± 25 µg PNA mg−1DNPs. These systems are used for in vitro studies to evaluate the kinetic release, biocompatibility, cellular uptake, and activity on different cancer cells expressing high levels of PD‐L1. The obtained results prove the safety of the NPs up to 200 µg mL−1 and their advantage for controlling and enhancing the PNA intracellular release as well as antitumor activity. Moreover, the downregulation of PD‐L1 observed only with MDA‐MB‐231 cancer cells paves the way for targeted immunotherapy.
Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.
We herein report an innovative antisense approach based on Peptide Nucleic Acids (PNAs) to down-modulate CD5 expression levels in chronic lymphocytic leukemia (CLL). Using bioinformatics tools, we selected a 12-mer tract of the CD5 mRNA as the molecular target and synthesized the complementary and control PNA strands bearing a serine phosphate dipeptide tail to enhance their water solubility and bioavailability. The specific recognition of the 12-mer DNA strand, corresponding to the target mRNA sequence by the complementary PNA strand, was confirmed by non-denaturing polyacrylamide gel electrophoresis, thermal difference spectroscopy, circular dichroism (CD), and CD melting studies. Cytofluorimetric assays and real-time PCR analysis demonstrated the downregulation of CD5 expression due to incubation with the anti-CD5 PNA at RNA and protein levels in Jurkat cell line and peripheral blood mononuclear cells from B-CLL patients. Interestingly, we also observed that transfection with the anti-CD5 PNA increases apoptotic response induced by fludarabine in B-CLL cells. The herein reported results suggest that PNAs could represent a potential candidate for the development of antisense therapeutic agents in CLL.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.