The blood brain barrier (BBB) represents a challenge in the development of new nano-delivery systems able to reach the central nervous system (CNS). In order to test the efficacy of these nanocarriers, it is fundamental to use in vitro models that resemble the in vivo cell culture conditions. Here, we demonstrate for the first time the ability of a membranotropic peptide, namely gH625, to transport a cargo-acting as a shuttle-across the BBB layer under flow conditions that mimic the blood flow rate. To this aim, a BBB microfluidic device was designed based on a transparent polyester porous membrane sandwiched between a top and a bottom overlying channel made of poly(methyl methacrylate) (PMMA). Our data clearly indicate that this microfluidic system allows the growth of brain endothelial bEnd.3 cells and the formation of a confluent layer at 7 days of culture that hinders the passage of nanoparticles compared to porous membrane alone. The device was validated at a 5 μL/min working flow rate, where the capability of the model to remain intact after nanoparticle passage was shown. Very interestingly, the decoration with the gH625 peptide enhances the adhesion of nanoparticles to the endothelial layer and the BBB crossing in flow conditions, thus confirming the efficacy of the gH625 as a delivery platform to the brain. Biotechnol. Bioeng. 2017;114: 1087-1095. © 2016 Wiley Periodicals, Inc.

The B-cell lymphoma 2 (Bcl-2) gene encodes for an antiapoptotic protein associated with the onset of many human tumors. Several oligonucleotides (ONs) and ON analogues are under study as potential tools to counteract the Bcl-2 expression. Among these are Peptide Nucleic Acids (PNAs). The absence of charges on PNA backbones allows the formation of PNA/DNA complexes provided with higher stability than the corresponding natural DNA/DNA counterparts. To date, the use of PNAs in antigene or antisense strategies is strongly limited by their inability to efficiently cross the cellular membranes. With the aim of downregulating the expression of Bcl-2, we propose here a novel antigene approach which uses oncolytic adenoviral vectors (OAds) as a new cancer cell-targeted PNA delivery system. The ability of oncolytic Ad5D24 vectors to selectively infect and kill cancer cells was exploited to transfect with high efficiency and selectivity a short cytosine-rich PNA complementary to the longest loop of the main G-quadruplex formed by the 23-base-long bcl2midG4 sequence located 52–30 bp upstream of the P1 promoter of Bcl-2 gene. Physico-chemical and biological investigations confirmed the ability of the PNA-conjugated Ad5D24 vectors to load and transfect their PNA cargo into human A549 and MDA-MB-436 cancer cell lines, as well as the synergistic (OAd+PNA) cytotoxic effect against the same cell lines. This approach holds promise for safer chemotherapy because of reduced toxicity to healthy tissues and organs.

A major issue in chemotherapy is the lack of specificity of many antitumor drugs, which cause severe side effects and an impaired therapeutic response. Here we report on the design and characterization of model tumor activated prodrug-conjugated polystyrene (PS) nanoparticles (TAP-NPs) for the release of doxorubicin (Dox) triggered by matrix metalloprotease-2 (MMP2) enzyme, which is overexpressed in the extracellular matrix of tumors. In particular, TAP-NPs were produced by attaching Dox to poly(ethylene glycol) (PEG) through two MMP2-cleavable enzymes. The resulting adduct was then tethered to PS NPs. Results showed that Dox release was actually triggered by MMP2 cleavage and was dependent on enzyme concentration, with a plateau around 20 nM. Furthermore, significant cell cytotoxicity was observed towards three cell lines only in the presence of MMP2, but not in cells without enzyme pre-treatment, even after NP internalization by cells. These findings indicate the potential of TAP-NPs as suitable nanocarriers for an on demand, tumor--specific delivery of antitumor drugs after the response to an endogenous stimulus. Further advancements will focus on the translation of this production technology to biodegradable systems for the safe transport of cytotoxic drug to tumor tissues.

By combining the ability of short G-rich oligodeoxyribonucleotides (ODNs) containing the sequence 5'CGGA3' to form higher order G-quadruplex (G4) complexes with the tetra-end-linked (TEL) concept to produce aptamers targeting the HIV envelope glycoprotein 120 (gp120), three new TEL-ODNs (1-3) having the sequence 5'CGGAGG3' were synthesized with the aim of studying the effect of G4 dimerization on their anti-HIV activity. Furthermore, in order to investigate the effect of the groups at the 5' position, the 5' ends of 1-3 were left uncapped (1) or capped with either the lipophilic dimethoxytrityl (DMT) (2) or the hydrophilic glucosyl-4-phosphate (3) moieties. The here reported results demonstrate that only the DMT-substituted TEL-ODN 2 is effective in protecting human MT-4 cell cultures from HIV infection (76% max protection), notwithstanding all the three new aptamers proved to be capable of forming stable higher order dimeric G4s when annealed in K+-containing buffer, thus suggesting that the recognition of a hydrophobic pocket on the target glycoprotein by the aptamers represents a main structural feature for triggering their anti-HIV activity.

Square microchannels are easy to fabricate by means of micromachining or lithographic techniques. However, in vitro vascular microcapillaries--as well as plug production and microparticle alignment--require mainly circular microchannels that can be used also in applications based on open microchannels. Nowadays, a simple, low cost, and versatile method to fabricate circular microchannels is still missing. Here, we report on a fast, inexpensive, flexible and reproducible method to fabricate circular microchannels by coupling spin coating with micromilled square microchannels. The proposed method is based on the balance between the displacement of liquid PDMS induced by centrifugal forces and the surface tension that tends to keep the liquid accumulated especially in the corners, which become therefore rounded. To show the versatility of the described experimental study we prepared a variety of rounded microchannels, including branched and PMMA-PDMS hybrid configuration microchannels. Finally, an endothelial cell layer was formed by culturing brain endothelial bEnd.3 cells inside the proposed circular microchannels. Results demonstrated a more successful adhesion, growth, and homogeneous distribution of the cells along the circular microchannel than those observed in the square microchannel used as a control.

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

The development of new strategies for enhancing drug delivery to the brain represents a major challenge in treating cerebral diseases. In this paper, we report on the synthesis and structural characterization of a biocompatible nanoparticle (NP) made up of poly(lactic-co-glycolic acid) (PLGA)-polyethylene glycol (PEG) co-polymer (namely PELGA) functionalized with the membranotropic peptide gH625 (gH) and the iron-mimicking peptide CRTIGPSVC (CRT) for transport across the blood-brain barrier (BBB). gH possesses a high translocation potency of the cell membrane. Conversely, CRT selectively recognizes the brain endothelium, which interacts with transferrin (Tf) and its receptor (TfR) through a non-canonical ligand-directed mechanism. We hypothesize that the delivery across the BBB of PELGA NPs should be efficiently enhanced by the NP functionalization with both gH and CRT. Synthesis of peptides and their conjugation to the PLGA as well as NP physical-chemical characterization are performed. Moreover, NP uptake, co-localization, adhesion under dynamic conditions, and permeation across in vitro BBB model are evaluated as a function of gH/CRT functionalization ratio. Results establish that the cooperative effect of CRT and gH may change the intra-cellular distribution of NPs and strengthen NP delivery across the BBB at the functionalization ratio 33% gH–66% CRT.

No abstract