No abstract

No abstract

Background: Mercury concentration in the blood is one of mercury exposure biomarkers. This study was conducted in Abuhamed mining area in Sudan, during the period from August 2012 to November 2014.The aim of the study was to evaluate serum mercury levels and to assess lung functions in artisanal gold miners. Methods: The study included 123 subjects, of them 83 were working in the gold mining area, beside 50 healthy volunteers from Khartoum State, as control group. Serum mercury was measured by direct mercury analyzer (DMA-80). Lung function tests were done with a portable spirometer. Data were analyzed using IBM SPSS Statistics version 20. Results:The study observed significant increase in serum mercury levels in the gold miners, when compared with control group (24.9 ± 32.24µg/l) versus (1.40 ± 0.94µg/l) with P value (0.000). The mean forced expiratory volume in the first second (FEV1) in the gold miners was (3.24 ± 0.57) versus (3.40 ± 0.39) in the control group, while the mean forced vital capacity (FVC) in the mercury exposed miners was (3.7 ± 0.69) versus (3.86 ± 0.60) in non-exposed control group. Conclusion: Serum mercury levels significantly increase in the traditional gold miners working in Abuhamed, while forced expiratory volume in the first second (FEV1) and forced vital capacity (FVC) decrease but with no statistical significance.

No abstract

No abstract

Rickets is a common disease among children with severe malnutrition; it may be associated with liver and renal failure as precipitating factors.Methods and materials: this study was done at JafarIbn Auf pediatric hospital, Sudan. Fifty-four children with rickets were included. Clinical, radiological, laboratory, as well as socioeconomic status, were assessed. Results:The mean age of the children with rickets was (22.3 ± 15.1 months), 38(70.4%) of the children had low sunlight exposure, 45(83.3%) from low-income families, 50(92.2%) were under weight, 25.9% were not breastfed, 41(75.9%) had ricketic rosary and 38(70.4%) had hand swelling. Out of all study population; 51(94.4%) of them showed hypocalcemia associated with hypophosphatemia and 50(92.6%) showed increased alkaline phosphatase levels. As risk factors; 8 (14.8%) of the study population had liver failure, while 6 (11.1%) had renal failure Conclusion: Rickets in JafarIbn Auf pediatric hospital is associated with poverty and malnutrition as well as low sunlight exposure. Liver failure and renal failure may be important precipitating factors for rickets in Sudanese children.

Background Interleukin-4 (IL-4) is a multifunctional cytokine; involved in the regulation of immune responses, as well as in the pathogenicity of many diseases, such as diabetes mellitus. Some researchers suggested that IL-4 protects the human pancreatic islet from cytotoxic damages, whereas others suggested some inhibitory actions of IL-4 on pancreatic islets. This study aimed to assess the role of IL-4 genotypes of intron 3 variable number of tandem repeats of the IL-4 gene in diabetic retinopathy and diabetic neuropathy in Sudanese patients with type 2 diabetes mellitus (T2DM). This case–control study was performed in a number of Khartoum state hospitals in Sudan. The study enrolled 181 Sudanese patients, 115 (57 females and 58 males) diagnosed with T2DM and 66 (29 females and 37 males) healthy persons who served as control subjects. Polymerase chain reaction was used for the analysis of IL-4, which was amplified using the following amplification sequence (forward primer: CACGACGTTGTAAAACGACTAGGCTGAAAGGGGGAAAGC; reverse primer: CTGTTCACCTCAACTGCTCC). Biochemical analyses for highly sensitive C- reactive protein (hs-CRP), glycated hemoglobin (HbA1c), fasting plasma glucose, total cholesterol, triglycerides, low-density lipoprotein, and high-density lipoprotein were performed using a chemical analyzer. Results The study showed that in the diabetic group, 49(42.6%) had diabetic retinopathy, whereas 7(6.1%) had diabetic neuropathy. The B1B1 genotype was found to be a higher risk factor for developing diabetic retinopathy than B2B2 [P = 0.028; Odds ratio (OR) = 1.381; 95% confidence interval (CI) 1.344–9.062], whereas the B1B2 genotype was found to be insignificantly associated with retinopathy (P = 0.357; OR = 1.570; 95% CI 0.654–3.887). Furthermore, hs-CRP and HbA1c were significantly increased in diabetic neuropathy with IL-4 B1B1 genotype. Conclusions IL-4 gene polymorphisms can be good markers for the early identification of risk for diabetic retinopathy and neuropathy in Sudanese people. The hs-CRP and HbA1c in diabetic patients with IL-4 B1B1 genotype may be predisposition predictors of diabetic neuropathy.

Background. Hemophilia (HB) is an X-linked, recessive bleeding disorder characterized by the deficiency or absence of the coagulation factor IX. Usually, females are carriers of the trait, while males are affected. FIX deficiency leads to uncontrollable bleeding events, and the severity is dependent on the levels of the clotting factor. The objective of this research was to measure the prevalence of bleeding tendency in Sudanese carriers of HB. Materials and Methods. In this cross-sectional study, 88 Sudanese carriers of HB participated. The activated partial thromboplastin time test (APTT) and FIX test were performed for each carrier. The frequencies of DNA polymorphism and FIX-linked restriction fragments BamHI, HhaI, and MnII were also assessed. The study was conducted in Khartoum, Sudan, during the period from 2015 to 2017. Results. The study showed that 55 (62.5%) HB carriers were from the Laban village in the White Nile State, and all of them were members of the Shinkheb tribe. The mean age of the study population was 26.3 years. Among the carriers, 57 (64.7%) had abnormal coagulation profiles. The mean value of the APTT level among carriers was significantly increased ( P value: 0.000), while the mean concentration of the FIX levels among the carriers was significantly decreased ( P value: 0.000). The study also showed a negative correlation between PTT and F assay with P value of 0.000 and R value of 0.578. Conclusion. The APTT is high in most carriers and the FIX assay level is low in most carriers. Most carriers had no symptoms and were not bleeding. The Shinkheb tribe is the most ethnic tribe carrying HB (62.5%). HhaII is more informative for carrier detection than others, but it is of significant value if both (MnII and HhaII) were performed in parallel. In Sudanese, BamHI was informative but MnII and HhaII were best in the mutation detection and for prenatal diagnosis.