Hypercholesterolemia is a risk factor for estrogen receptor (ER) positive breast cancers and is associated with a decreased response of tumors to endocrine therapies. Here we show that 27-Hydroxycholesterol (27HC), a primary metabolite of cholesterol and an ER and Liver X receptor (LXR) ligand, increases ER-dependent growth and LXR-dependent metastasis in mouse models of breast cancer. The effects of cholesterol on tumor pathology required its conversion to 27HC by the cytochrome P450 oxidase CYP27A1, and were attenuated by treatment with CYP27A1 inhibitors. In human breast cancer specimens, CYP27A1 expression levels correlated with tumor grade. In high-grade tumors, both tumor cells and tumor-associated macrophages exhibited high expression levels of the enzyme. Thus, lowering circulating cholesterol levels or interfering with its conversion to 27HC may be a useful strategy to prevent and/or treat breast cancer.

Recruitment of transcriptional coactivators following ligand activation is a critical step in nuclear receptor-mediated target gene expression. Upon binding an agonist, the receptor undergoes a conformational change which facilitates the formation of a specific coactivator binding pocket within the carboxyl terminus of the receptor. This permits the alpha-helical LXXLL motif within some coactivators to interact with the nuclear receptors. Until recently, the LXXLL motif was thought to function solely as a docking module; however, it now appears that sequences flanking the core motif may play a role in determining receptor selectivity. To address this issue, we used a combinatorial phage display approach to evaluate the role of flanking sequences in influencing these interactions. We sampled more than 10(8) variations of the core LXXLL motif with estradiol-activated estrogen receptor alpha (ERalpha) as a target and found three different classes of peptides. All of these peptides interacted with ERalpha in an agonist-dependent manner and disrupted ERalpha-mediated transcriptional activity when introduced into target cells. Using a series of ERalpha-mutants, we found that these three classes of peptides showed different interaction patterns from each other, suggesting that not all LXXLL motifs are the same and that receptor binding selectivity can be achieved by altering sequences flanking the LXXLL core motif. Most notable in this regard was the discovery of a peptide which, when overexpressed in cells, selectively disrupted ERbeta- but not ERalpha-mediated reporter gene expression. This novel ERbeta-specific antagonist may be useful in identifying and characterizing the ERbeta-regulated process in estradiol-responsive cells. In conclusion, using a combinatorial approach to define cofactor-receptor interactions, we have clearly been able to demonstrate that not all LXXLL motifs are functionally equivalent, a finding which suggests that it may be possible to target receptor-LXXLL interactions to develop receptor-specific antagonists.

containing 1 x 106 cpm of nick-translated probe per ml (12). After being washed three times at 60'C in 0.5 x SSC to remove excess probe, the filters were exposed to X-ray film (Kodak X-Omat S) at -700C with an intensifying screen. Hybridization-positive phage were isolated, and their inserts were subcloned into the EcoRI site of M13mp8. AVDR1 was obtained in this fashion and subsequently used to screen an Okayama-Berg (13) T47D cDNA library (provided by G. Ringold, Stanford University), yielding clone VDR3, and a specifically primed AgtlO T47D library yielding clone AVDR2. The latter was made by substituting the oligonucleotide 5' ACACACCCCACAGATCCGGGG 3' for oligo(dT) in the first strand reaction (underlined in Fig. 2).DNA Sequence Analysis. Three overlapping clones were used to generate the full-length VDR sequence cDNA inserts to be sequenced. These clones were subcloned into the EcoRI site of M13mp8 for sequencing by the dideoxynucleotide chain-termination method (14). Primers were either the M13 universal primer or sequence-derived oligonucleotides.RNA Blot Hybridization. Total RNA was isolated from each of three cell lines (15), and the mRNA fraction was selected by successive passages over oligo(dT)-cellulose (16). The mRNA samples (10 ,ug) were resolved on a 1% formaldehyde-agarose gel (17) and then transferred electrophoretically to a nylon membrane (Nytran; Schleicher & Schuell). The filter was hybridized to nick-translated hVDR-1(1 x 108 cpm/,ug; 1 x 106 cpm/ml) using the conditions described above.Expression

Estrogen regulates a plethora of functionally dissimilar processes in a broad range of tissues. Recent progress in the study of the molecular mechanism of action of estrogen(s) has revealed why different cells can respond to the same hormone in a different manner. Three of these findings are of particular importance: (i) There are two genetically and functionally distinct estrogen receptors that have distinct expression patterns in vivo; (ii) the positive and negative transcriptional activities of these receptors require them to engage transcription cofactors (coactivators or corepressors) in target cells; and (iii) not all cofactors are functionally equivalent, nor are they expressed in the same manner in all cells. Thus, although the estrogen receptor is required for a cell to respond to an estrogenic stimulus, the nature and extent of that response are determined by the proteins, pathways, and processes with which the receptor interacts.

The human estrogen receptor ␣-isoform (ER␣) is a nuclear transcription factor that displays a complex pharmacology. In addition to classical agonists and antagonists, the transcriptional activity of ER␣ can be regulated by selective estrogen receptor modulators, a new class of drugs whose relative agonist/antagonist activity is determined by cell context. It has been demonstrated that the binding of different ligands to ER␣ results in the formation of unique ER␣-ligand conformations. These conformations have been shown to influence ER␣-cofactor binding and, therefore, have a profound impact on ER␣ pharmacology. In this study, we demonstrate that the nature of the bound ligand also influences the stability of ER␣, revealing an additional mechanism by which the pharmacological activity of a compound is determined. Of note we found that although all ER␣-ligand complexes can be ubiquitinated and degraded by the 26 S proteasome in vivo, the mechanisms by which they are targeted for proteolysis appear to be different. Specifically, for agonist-activated ER␣, an inverse relationship between transcriptional activity and receptor stability was observed. This relationship does not extend to selective estrogen receptor modulators and pure antagonists. Instead, it appears that with these compounds, the determinant of receptor stability is the ligand-induced conformation of ER␣. We conclude that the different conformational states adopted by ER␣ in the presence of different ligands influence transcriptional activity directly by regulating cofactor binding and indirectly by modulating receptor stability. ER␣1 resides within the nuclei of target cells in an inactive form in the absence of hormone. Upon binding its cognate ligand estradiol, the receptor undergoes an activating conformational change permitting it to interact with specific cofactors and bind DNA response elements within target gene promoters (1, 2). The DNA-bound receptor-ligand complex is then capable of either activating or repressing target gene transcription, depending on both the cell and the promoter context. The classical model of ER␣ action suggests that the role of agonists, such as estradiol, is that of a switch converting the receptor from an inactive to an active form. It now appears that ER␣ pharmacology is more complex, since it has been observed that different ER␣-ligands induce different changes in receptor conformation and that target cells can distinguish between these complexes (3-5). For instance, the anti-estrogen tamoxifen opposes estrogen action in the breast, whereas it manifests estrogenic activities in bone, the cardiovascular system, and the uterus. Reflecting its complex pharmacology, tamoxifen has recently been reclassified as a selective estrogen receptor modulator (SERM). Additional SERMs have been identified, such as raloxifene, GW5638, TSE424, lasofoxifene, and arzoxifene, each of which has distinct agonist/antagonist profiles (6). The challenge, therefore, has been to understand the mechanism(s) underlying SERM-mediated action an...

No abstract

Aldehyde dehydrogenase (ALDH) is an enzyme that is expressed in the liver and is required for the conversion of retinol (vitamin A) to retinoic acids. ALDH is also highly enriched in hematopoietic stem cells (HSCs) and is considered a selectable marker of human HSCs, although its contribution to stem cell fate remains unknown. In this study, we demonstrate that ALDH is a key regulator of HSC differentiation. Inhibition of ALDH with diethylaminobenzaldehyde (DEAB) delayed the differentiation of human HSCs that otherwise occurred in response to cytokines. Moreover, short-term culture with DEAB caused a 3.4-fold expansion in the most primitive assayable human cells, the nonobese diabetic͞severe combined immunodeficiency mouse repopulating cells, compared with day 0 CD34 ؉ CD38 ؊ lin ؊ cells. The effects of DEAB on HSC differentiation could be reversed by the coadministration of the retinoic acid receptor agonist, all-trans-retinoic acid, suggesting that the ability of ALDH to generate retinoic acids is important in determining HSC fate. DEAB treatment also caused a decrease in retinoic acid receptor-mediated signaling within human HSCs, suggesting directly that inhibition of ALDH promotes HSC self-renewal via reduction of retinoic acid activity. Modulation of ALDH activity and retinoid signaling is a previously unrecognized and effective strategy to amplify human HSCs.retinoic acid ͉ self-renewal ͉ diethylaminobenzaldehyde ͉ long-term repopulating cells H ematopoietic stem cells (HSCs) possess the unique capacity to self-renew and give rise to all mature lymphohematopoietic progeny throughout the lifetime of an individual (1, 2). Several molecular pathways that regulate HSC self-renewal have now been identified, including Notch (3), HOXB4 (4), Wnt (5), and bone morphogenetic protein signaling pathways (6). The osteoblastic niche for HSCs within the bone marrow (BM) has also been characterized (7,8). Despite these advances in understanding HSC biology, clinical methods to amplify human HSCs have yet to be realized, and characterization of the pathways that regulate HSC self-renewal continues to evolve.Two decades ago, Colvin et al. (9,10) demonstrated that the intracellular enzyme, aldehyde dehydrogenase (ALDH), protected BM progenitors from the cytotoxic effects of cyclophosphamide by deactivation of its metabolite, 4-hydroxycyclophosphamide (9, 10). Several isoforms of ALDH have been identified, with ALDH1 being the primary isoform expressed within human hematopoietic progenitors (11,12). Recent studies have shown that human and murine hematopoietic progenitors can be isolated by using a fluorescently labeled dye specific for ALDH activity (13-16) and cord blood (CB) ALDH br lin Ϫ cells are enriched for nonobese diabetic͞severe combined immunodeficiency (NOD͞SCID) mouse repopulating cells [SCID-repopulating cells (SRCs)] (15, 16). Although these data demonstrate that ALDH is a selectable marker for human stem͞progenitor cells, the HSC-specific function of ALDH remains unknown. In the liver, ALDH1 contributes prima...

Selective estrogen receptor (ER) modulators (SERMs) are ER ligands whose relative agonist/antagonist activities vary in a cell- and promoter-dependent manner. The molecular basis underlying this selectivity can be attributed to the ability of these ligands to induce distinct alterations in ER structure leading to differential recruitment of coactivators and corepressors. Whether SERM activity is restricted to synthetic ligands or whether molecules exist in vivo that function in an analogous manner remains unresolved. However, the recent observation that oxysterols bind ER and antagonize the actions of 17beta-estradiol (E2) on the vascular wall suggests that this class of ligands may possess SERM activity. We demonstrate here that 27-hydroxycholesterol (27HC), the most prevalent oxysterol in circulation, functions as a SERM, the efficacy of which varies when assessed on different endpoints. Importantly, 27HC positively regulates both gene transcription and cell proliferation in cellular models of breast cancer. Using combinatorial peptide phage display, we have determined that 27HC induces a unique conformational change in both ERalpha and ERbeta, distinguishing it from E2 and other SERMs. Thus, as with other ER ligands, it appears that the unique pharmacological activity of 27HC relates to its ability to impact ER structure and modulate cofactor recruitment. Cumulatively, these data indicate that 27HC is an endogenous SERM with partial agonist activity in breast cancer cells and suggest that it may influence the pathology of breast cancer. Moreover, given the product-precursor relationship between 27HC and cholesterol, our findings have implications with respect to breast cancer risk in obese/hypercholesteremic individuals.