Genetic analysis of natural variation in ecotypes of Arabidopsis thaliana can facilitate the discovery of new genes or of allelic variants of previously identified genes controlling physiological processes in plants. We mapped quantitative trait loci (QTL) for light response in recombinant inbred lines (RILs) derived from the Columbia and Kashmir accessions via two methods: composite interval mapping and eXtreme array mapping (XAM). After measuring seedling hypocotyl lengths in blue, red, far-red, and white light, and in darkness, eight QTL were identified by composite interval mapping and five localized near photoreceptor loci. Two QTL in blue light were associated with CRY1 and CRY2, two in red light were near PHYB and PHYC, and one in far-red light localized near PHYA. The RED2 and RED5 QTL were verified in segregating lines. XAM was tested for the identification of QTL in red light with pools of RILs selected for extreme phenotypes. Thousands of single feature polymorphisms detected by differential DNA hybridized to high-density oligo-nucleotide arrays were used to estimate allele frequency differences between the pools. The RED2 QTL was identified clearly; differences exceeded a threshold of significance determined by simulations. The sensitivities of XAM to population type and size and genetic models were also determined by simulation analysis. LIGHT is important for plant growth and morphoregulators of light signal transduction, including photogenesis, affecting germination, seedling developreceptors such as PHYA (Dehesh et al. 1993; Parks and ment, shade avoidance, flowering, and photosynthesis.Quail 1993), PHYB (Somers et al. 1991; Reed et al. 1993; Seedling development has been studied extensively in Wester et al. 1994), and CRY1 (Ahmad and Cashmore Arabidopsis thaliana as a model for elucidating mecha-1993), identified in far-red, red, and blue light, respecnisms of light signal transduction and has revealed a tively. Classical mutant screens, however, are limiting network of genes encoding photoreceptors, transcripbecause redundant genes or those with small effects are tion factors, and other interacting proteins (Quail difficult to identify. 2002; Kevei and Nagy 2003; Wang and Deng 2003 of eXtreme array mapping (XAM) was developed that Primers for MSAT markers added to the map can be found extends the use of array hybridization and bulk segreat http:/ /www.inra.fr/qtlat/ while those for all remaining markers gant mapping to quantitative traits.can be found at The Arabidopsis Information Resource (http:/ / www.arabidopsis.org/), except those for the Atchib2 marker (forward, GGATCCAAGTGCTCATATATAC; reverse, CTTTC GTTTCTAAATATGAGAAGC). PCR was conducted for 40 cy-MATERIALS AND METHODS cles; each cycle included a 30-sec denaturation at 94Њ, a 30-sec Plant material: A set of 128 RILs (F 6 ) derived from Col-gl1 annealing at 50Њ, and a 30-sec elongation at 72Њ. The 40 cycles and Kas-1 genotypes (Wilson et al. 2001) and parental lines were preceded by a 1-min denaturation at 94Њ and followed by ...

The ability of nonpathogenic isolates of Fusarium oxysporum (np Fo ) to induce systemic resistance and defence responses against subsequent challenge with a pathogenic strain of F. oxysporum f. sp. asparagi ( Foa ) was examined in Asparagus officinalis . In a split-root experiment, roots inoculated with np Fo exhibited a hypersensitive response and those subsequently inoculated with Foa displayed resistance. Induction of systemic resistance in np Fo -treated plants led to significantly fewer necrotic lesions ( P = 0·05) and reduced Foa disease severity compared with plants not treated with np Fo . In hyphal-sandwich root inoculation experiments, activities of peroxidase and phenylalanine ammonia-lyase and lignin content were higher in np Fo -treated plants and increased more rapidly than in np Fo -untreated plants after Foa inoculation. Antifungal activity (inhibition of fungal spore germination and germ-tube growth) from exudates of roots inoculated with Foa were observed for np Fo -treated plants but not for np Fo -untreated plants. Thus, isolates of np Fo may function as inducers of systemic acquired resistance (SAR) and defence responses against Foa invasion in A. officinalis .

Pre-inoculation of asparagus ( Asparagus officinalis ) roots with selected nonpathogenic isolates of Fusarium oxysporum (np Fo ) has previously been shown to induce systemic resistance against infection by F. oxysporum f.sp. asparagi ( Foa ) through activation of plant-defence mechanisms. To elucidate the putative np Fo -mediated defence pathways, the effect of salicylic acid (SA) was examined in a split-root system of asparagus where one half of the seedling root system was drenched with SA and the activation of defence responses was measured subsequently on the remaining roots. SA-treated plants exhibited enhanced systemic resistance, with a significant reduction in disease severity of the roots inoculated with Foa , compared with untreated plants. SA activated peroxidase and phenylalanine ammonia-lyase, as well as lignification, upon Foa attack, in a manner similar to that observed with np Fo pretreatment. In addition, application of diphenyleneiodonium, an SA biosynthesis inhibitor, led to failure of np Fo to induce lignin deposition and systemic resistance. Treatment of fungal spores with SA did not affect germination and growth of either np Fo or Foa in in vitro antifungal assays. Production of SA at the site of np Fo infection may be involved in the induction of Foa resistance in asparagus roots.

Succinate semialdehyde (SSA) is a mitochondrially generated intermediate in the metabolism of γ-aminobutyrate (GABA), which accumulates in response to a variety of biotic and abiotic stresses. SSA can be reduced to γ-hydroxybutyrate (GHB) in plants exposed to various abiotic stress conditions. Recent evidence indicates that distinct cytosolic and plastidial glyoxylate reductase isoforms from Arabidopsis thaliana (L.) Heynh (GLYR1 and GLYR2, respectively) catalyze the in vitro conversion of SSA to GHB, as well as glyoxylate to glycolate, via NADPH-dependent reactions. In the present study, recombinant Arabidopsis GLYR1 was demonstrated to catalyze the NADPH-dependent reduction of both glyoxylate and SSA simultaneously to glycolate and GHB, respectively. Six-hour time-course experiments with intact vegetative wild-type Arabidopisis plants subjected to submergence demonstrated that GHB accumulates in rosette leaves, and this is accompanied by increasing levels of GABA and alanine, NADH/NAD+ and NADPH/NADP+ ratios, and GLYR1 and GLYR2 transcript abundance. The use of GLYR (glyr1 or glyr2 knockout) and NAD kinase1 (NADK1 suppression or overexpression) mutants demonstrated that under submergence the production of GHB is mediated via both GLYR isoforms, the loss of either GLYR1 or GLYR2 activity influences redox status and the levels of GABA and alanine, and the manipulation of NADP(H) availability, specifically in the cytosol, influences the production of GHB. These results suggest that biochemical mechanisms are more important than transcriptional mechanisms in the regulation of GLYR activity and SSA detoxification in plants during the onset of submergence-induced oxygen deficiency.

The role of lateral root nodules in N2 fixation and the relationships between total shoot N and several traits which influence or control N2 fixation in common bean (Phaseolus vulgaris L.) i.e., acetylene reduction value, specific nodule activity, leghemoglobin concentration, total leghemoglobin and nodule mass, were investigated in field studies. Significant variation among bean lines was observed for all the traits measured. Lines varied for the proportion of total N accumulated up to the R3 growth stage, thus measurements of total shoot N near maturity (e.g., R7) provided a better estimate of total N2 fixation than measurements taken at an early growth stage. Nodule mass was correlated with acetylene reduction and total leghemoglobin, and total leghemoglobin was correlated with acetylene reduction value. Total shoot N at R7 was correlated with seasonal means of nodule mass and number, acetylene reduction value and total leghemoglobin. For all traits except total leghemoglobin, values for lateral roots were more highly correlated with total shoot N than were values for either crown roots or the whole root system. Seed yield was most highly correlated with nodule mass of the lateral roots. These results will be useful in devising breeding strategies for improved N2 fixation of the host plant.