The global population is expected to increase by approximately 3 billion people by 2050. With this increase in population, industry, transportation the cost of fossil fuels will grow dramatically. New technologies are needed for fuel extraction using feedstocks that do not threaten food security, cause minimal or no loss of natural habitat and soil carbon. At the same time, waste management has to be improved and environmental pollution should be minimized or eliminated. Liquid biofuels such as lignocellulosic‐based ethanol from plant biomass and algal‐based biodiesel are sustainable, alternative biofuels that could stabilize national security and provide clean energy for future generations. Ideally, the technology should also foster recycling of agricultural feedstocks and improve soil fertility and human health. This article provides updated information on the energy potential and breadth of liquid biofuel biotechnology.
Sugarcane hybrids are complex aneu-polyploids (2n = 100-130) derived from inter-specific hybridization between ancestral polyploid species, namely S. officinarum L. and S. spontaneum L. Efforts to understand the sugarcane genome have recently been enhanced through the use of new molecular marker technologies. A framework genetic linkage map of Louisiana's popular cultivar LCP 85-384 was constructed using the selfed progeny and based on polymorphism derived from 64 AFLP, 19 SSR and 12 TRAP primer pairs. Of 1,111 polymorphic markers detected, 773 simplex (segregated in 3:1 ratio) and 182 duplex (segregate in 77:4 ratio) markers were used to construct the map using a LOD value of ≥ 4.0 and recombination threshold of 0.44. The genetic distances between pairs of markers linked in the coupling phase was computed using the Kosambi mapping function. Of the 955 markers, 718 simplex and 66 duplex markers were assigned to 108 co-segregation groups (CGs) with a cumulative map length of 5,617 cM and a density of 7.16 cM per marker. Fifty-five simplex and 116 duplex markers remained unlinked. With an estimated genome size of 12,313 cM for LCP 85-384, the map covered approximately 45.6% of the genome. Forty-four of the 108 CGs were assigned into 9 homo(eo)logous groups (HGs) based on information from locus-specific SSR and duplex markers, and repulsion phase linkages detected between CGs. Meiotic behavior of chromosomes in cytogenetic studies and repulsion phase linkage analysis between CGs in this study inferred the existence of strong preferential chromosome pairing behavior in LCP 85-384. This framework map marks an important beginning for future mapping of QTLs associated with important agronomic traits in the Louisiana sugarcane breeding programs.
A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5′ CCGAAGTGAGCAGATTGACC) and Cxx2 (5′ ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.
Understanding latitudinal adaptation of switchgrass (Panicum virgatum L.) and Miscanthus (Miscanthus× giganteus J. M. Greef & Deuter ex Hodk. & Renvoize) to the southern Great Plains is key to maximizing productivity by matching each grass variety to its optimal production environment. The objectives of this study were: (1) to quantify latitudinal variation in production of representative upland switchgrass ecotypes (Blackwell, Cave-in-Rock, and Shawnee), lowland switchgrass ecotypes (Alamo, Kanlow), and Miscanthus in the southern half of the US Great Plains and (2) to investigate the environmental factors affecting yield variation. Leaf area and yield were measured on plots at 10 locations in Missouri, Arkansas, Oklahoma, and Texas. More cold winter days led to decreased subsequent Alamo switchgrass yields and increased subsequent upland switchgrass yields. More hot-growing season days led to decreased Kanlow and Miscanthus yields. Increased drought intensity also contributed to decreased Miscanthus yields. Alamo Electronic supplementary material The online version of this article
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.