Two novel alleles at the goat CSN1S2 locus have been identified: CSN1S2(F) and CSN1S2(D). Sequence analyses revealed that the CSN1S2(F) allele is characterized by a G --> A transition at the 13th nucleotide in exon 3 changing the seventh amino acid of the mature protein from Val to Ile. The CSN1S2(D) allele, apparently associated with a decreased synthesis of alpha s2-casein, is characterized by a 106-bp deletion, involving the last 11 bp of the exon 11 and the first 95 bp of the following intron. Methods (PCR-RFLP and PCR) for identification of carriers of these alleles have been developed.
The relative amounts of the four casein fractions (as1, b, as2 and k) affect the physico-chemical, nutritional and technological properties of milk of domestic ruminants 1 .Polymorphism at the CSN1S1 locus in goat species is of interest because of its high degree of polymorphism and differences in the level of protein synthesis.The A, B and C alleles are associated with a 'high' level of as1-casein in milk (around 3.5 g/l), the E allele with a 'medium' level (1.1 g/l), the F and G alleles with a 'low' level (0.45 g/l), 0 1 and 0 2 alleles being 'null' alleles, without as1-casein in the milk of homozygotes. Recently, the B allele has been divided into four alleles: B 1 (considered as the ancestor allelic form), B 2 (previously idenfied as B), B 3 and B 4 2 . A single nucleotide deletion (C) at the 23rd nucleotide of the ninth exon and two insertions, one of 11 bp (CGTAATGTTTC), located 73 nucleotides downstream of the 5% splice site of the ninth intron, and the other of 3 bp (AAT or TAA), interrupting the long polypyrimidine stretch upstream of the 3% splice site of the ninth intron, were identified as mutations potentially responsible for the alternative skipping of exons 9, 10 and 11 of the goat CSN1S1 F allele 3 .Though the deletion inside the ninth exon was confirmed by means of polymerase chain reaction (PCR) amplification with allele specific primers 3 , no method for identification of the insertions/ deletions of the ninth intron has been proposed. The aim of the present study was to develop a method for a simultaneous typing for the deletion at the ninth exon and the 11-bp insertion in the downstream intron.Milk and blood samples were obtained from 180 unrelated goats belonging to an undefined genetic type reared in Southern Italy. Milk samples were analysed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) at alkaline pH. DNA was estracted from leucocytes 4 obtained from blood samples collected with Na 2 EDTA as anticoagulant.All the DNA samples were analysed for the presence of CSN1S1 F and CSN1S1 01 alleles by two Allele Specific-PCRs ( 3 ; Ramunno, Table 1. Observed allele and haplotype frequencies after XmnI digestion of fragment obtained by means of PCR of the DNA region spanning from the eighth to the ninth intron of goat CSN1S1 gene Frequency Haplotype Frequency RFLP (bp) Allele 0.3750 223personal communication) and the CSN1S1 E allele by PCR 5 . The region of the goat CSN1S1 gene between nucleotides 208 and 420 (EMBL accession number X59835; 3 ) spanning part of eigth intron, the ninth exon and part of the ninth intron was amplified and digested with XmnI.The PCR was carried out in a 50 ml reaction mixture containing: 100 ng of genomic DNA, 10 pmol of each primer (forward: 5% TTCTAAAAGTCTCAGAGGCAG 3%, reverse: 5% GGGTTGATAGCCTTGTATGT 3%), 1.25 U of Taq DNA polymerase (Promega, Italia, Milano, Italy), 50 mM KCl, 10 mM Tris -HCl (pH 9.0), 0.1% Triton X-100, 3 mM MgCl 2 , dNTPs each at 400 mM, 0.04% BSA.The amplification protocol consisted: an initial cycle of 97°C for 2 min, 6...
The goat calcium-sensitive caseins (alphas1, beta and alphas2) represent, over many years, an excellent model for demonstrating that the major part of the variability observed in the content of these proteins in goat milk is mostly due to the presence of autosomal alleles at single structural loci (CSN1S1, CSN2 and CSN1S2 respectively) clustered on a 200 kb segment of chromosome 6; furthermore, CSN1S1 and CSN2 are convergently transcribed and are only 12 kb apart (Rijnkels, 2002).
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.