PapersConclusions The prevalence of the selected cardiovascular risk factors is common in the adult Sri Lankan population surveyed. Regional differences exist in the prevalence of these risk factors. The prevalence of high level of risk factors requires urgent public health action. AbstractObjective To determine the prevalence of selected cardiovascular risk factors in adult Sri Lankan population in four provinces.Design Cross-sectional, based on a stratified cluster sampling method.Settings Four provinces, namely the Western, North Central, Southern and Uva.Patients Six thousand and forty seven participants (2692 men) between the age of 30 and 65 years were surveyed.Measurements Risk factors measured included height, weight, waist and hip circumference. Waist to hip ratio and body mass index were calculated, and overweight (23 kg/m 2 ) and obesity (≥25 kg/m 2 ) determined. Hypertension (systolic blood pressure ≥ 140 mmHg or diastolic blood pressure ≥ 90 mmHg or use of antihypertensive medications), and diabetes mellitus (fasting serum plasma glucose level ≥ 7 mmol/L or use of antidiabetic medications) and impaired fasting glycaemia (≥ 6.1 to < 7 mmol/L) were also determined.Results The prevalence of hypertension as defined was 18.8% (CI 14.5-23.1) for men and 19.3% for women. The prevalence of diabetes was 14.2% (CI 11.9-16.5) for men and 13.5% (CI 6.9-20.1) for women while impaired fasting glycaemia was 14.2% for men and 14.1% for women. The mean body mass index was 21.5 kg/m 2 (SD = 3.7) in men. It was lower than that in women, 23.3 kg/m 2 (SD = 4.5). The prevalence of obesity was 20.3% in men and 36.5 % in women.Regional differences were seen in the mean fasting blood glucose and prevalence of diabetes, and mean BMI and prevalence of obesity were highest in Western province. Mean blood pressure and prevalence of hypertension were highest in the Uva Province. Southern Province had the lowest prevalence of hypertension and diabetes, and North Central Province had lowest anthropometric measures of obesity.

No abstract

Objectives To determine the association between environmental and occupational exposures, semen parameters and lead (Pb) and cadmium (Cd) levels in seminal plasma of men investigated for infertility.Methods Data were collected from 300 men investigated for infertility using an interviewer administered questionnaire. Seminal fluid analysis and classification was done according to WHO guidelines. Positive exposure was defined as environmental or occupational exposure to agro or industrial chemicals, heavy metals and living in areas within 50m of potential sources of pollution for three months or more. Seminal plasma lead and cadmium levels were estimated by graphite furnace atomic absorption spectrophotometry after digestion with nitric acid. The means of sperm parameters, Pb and Cd concentrations between exposed and non exposed groups were compared using t-test.Results Mean age was 34.8 (95% CI 34.2-35.4) years BMI was 24.3 (95% CI 23.8-24.7) kg/m 2 and duration of the infertility was 45.7 (41.7-49.6) months. In this study, 54.6% were exposed to toxins through environmental or occupational sources. All sperm parameters were lower in the exposed group when compared to the non exposed. Lead and cadmium were detected in 38.3% and 23% of men respectively. The distance from the source of possible environmental or occupational exposure was negatively correlated to seminal plasma Pb (r=0.06, p>0.05) and Cd (r=0.26, p<0.05) concentrations. In the exposed, mean IntroductionGlobally, human fecundity appears to be on the decline with decrease in semen quality and male infertility being on the rise [1,2]. Environmental pollutants, occupational exposures and life style factors have been explored as possible contributors [3]. Toxicants affecting the reproductive system are broadly categorised as petroleum products, agrochemicals, industrial chemicals and heavy metals. The effects of exposure to toxicants and male infertility have been reported by many investigators [4]. However the results vary according to the study population, the methods used in the assessment of exposure and the biological end point.Of the heavy metals known to impair semen quality, lead (Pb) and cadmium (Cd) are the two most prevalent Ceylon Medical Journal 2015; 60: 52-6 lead concentration was 17.7 (95% CI 15.0-20.4) µg/dl and 13.5 (95% CI 11.2-15.7) µg/dl in non exposed and cadmium concentration in exposed was 1.2 (95% CI 1.1-1.4) µg/dl and 1.1 (0.9-1.3) µg/dl in non-exposed.Conclusions Environmental and occupational exposures were associated with reduced sperm count motility, viability, normal forms and detectable levels of lead and cadmium in seminal plasma.

Objective To determine the clinicopathological features of colorectal malignancies in Sri Lankan patients aged 40 years or younger, and to compare them with those of older patients. Methods The clinicopathological features of 60 colorectal malignancies which occurred in patients aged 40 years or younger were compared with 245 malignant colorectal tumours in older patients. These tumours had been diag nosed at a University Department of Pathology over 15 years. Results 19.7% of colorectal malignancies occurred in pa tients aged 40 years or younger. (Male: Female ratio = 1.6:1). The mean duration from onset of symptoms to di agnosis was 4.2 months. There was no statistically sig nificant difference between young and old patients in the presenting symptoms, site of tumour and Dukes' staging of colorectal malignancies. A statistically significant pro portion of tumours in young patients was mucoid (13.3%) or signet ring cell (5%) type. 3.3% of young patients with colorectal carcinoma gave a family history of similar ma lignancy. A history of predisposing conditions (ulcerative colitis) was present in 3.3% of young patients. Conclusions The clinical presentation of colorectal ma lignancies in Sri Lankan patients below 40 years of age does not differ from that in older patients. Mucoid and signet ring cell carcinomas are commoner in the young.

Objectives: Torture has been documented in 132 countries, and approximately 400,000 survivors of torture reside in the United States. It is unknown if torture survivors seek medical care in emergency departments (EDs). The authors set out to estimate the prevalence of survivors of torture presenting to an urban ED.Methods: A cross-sectional survey of ED patients was performed by convenience sampling from October 2008 to September 2009 in a large urban teaching hospital in New York City. ED patients not of a vulnerable population were consented and entered into the study. Participants were asked two screening questions to ascertain if they were self-reported survivors of torture. For exploratory purposes only, these individuals were further queried about their experiences. The detailed responses of these self-reported survivors of torture were compared to the United Nations Convention Against Torture (UNCAT) definition by a blinded, independent panel.Results: Of 470 study participants, 54 individuals (11.5%, 95% confidence interval [CI] = 8.6% to 14.4%) self-reported torture. Nine (16.7%) had ongoing physical disabilities, 30 (55.6%) had recurrent intrusive and distressing memories, 42 (77.8%) never had a physician inquire about torture, and only eight (14.8%) had requested political asylum. Of these self-reported survivors of torture, 29 (53.7%) met the UNCAT definition, for an adjudicated prevalence of 6.2% (95% CI = 4.3% to 8.7%).Conclusions: Self-reported survivors of torture presented to this urban ED, and a significant proportion of them met the UNCAT definition of a torture survivor. Continuing torture-related medical and psychological sequelae were identified, yet there was a low rate of asylum-seeking. Only a minority were previously identified by a physician. These data suggest an unrecognized public health concern and an opportunity for emergency physicians to intervene and refer survivors of torture to existing community resources.

The available evidence suggests that several products are capable of significantly improving some, but not all, of the symptoms related to alcohol hangover. Therefore, further research is necessary to develop clinically effective hangover treatments.

Fifty-seven Sinhalese patients were investigated for the presence of Helicobacter pylori by PCR. A prevalence of 70.1%, with 47.5% positive for cagA, was demonstrated. The most common vacA allele was s1am1. There was no significant association between either the s1 allele or the cagA allele and severe gastroduodenal disease. There was an association between the s1 allele and the cagA locus.Helicobacter pylori is one of the most common causes of chronic bacterial infections in humans and is important in the pathogenesis of gastrointestinal disease, such as duodenal ulcer, gastric ulcer, gastric cancer, and lymphoma (1, 2).Only three studies have reported on the prevalence of H. pylori in Sri Lanka, using either culture or a rapid urease test (RUT). In one study using the RUT, a prevalence of 46% was recorded in an adult symptomatic population (5), while in a study using culture and the RUT, only 12% of a symptomatic population aged 18 to 80 years were recorded as colonized (3). More recently, only 2.9% of 67 patients with functional dyspepsia were positive by the RUT (4). In India, a prevalence of 80% has been reported.Because the H. pylori strains prevalent in Sri Lanka have not previously been reported upon, the objectives of this study were to determine their prevalence by using PCR, as it is sensitive (7), gives an indication of current infection, and yields additional information regarding the type of strain colonizing the individual.Fifty-seven dyspeptic Sinhalese patients were enrolled; 41 were males and 16 were females, with an age range of 4 to 74 years (mean, 44 years). Two gastric biopsy samples were taken from the antrum for histology and DNA studies. The DNA was extracted by using a PuregeneD-5500A kit (Flowgen, Ashby de la Zouch, United Kingdom). PCRs for the vacA, cagA, 16S rRNA, and glmM genes were carried out with the primers noted below, using prealiquoted PCR Mastermix in thermotubes (AB Gene, Epsom, Surrey, United Kingdom). The vacA "s" region was amplified with VA1-F (5ЈATGGAAATACAA CAACACAC3Ј) and VA1-R (5ЈCTGCTTGAATGCGCCAA AC3Ј), which generate a 259-bp amplicon for the s1 allele and a 286-bp amplicon for the s2 allele. The vacA "m" region was amplified with HPMG-F (5ЈCACAGCCACTTTCAATAACG A3Ј) and HPMG-R (5ЈCGTCAAAATAATTCCAAGGG3Ј), which generate a 401-bp amplicon for the m1 allele and a 476-bp amplicon for the m2 allele. The cycle parameters were 95°C for 2 min (1 cycle) followed by 40 cycles of 95°C for 1 min, 50°C for 1 min, and 74°C for 1 min with a final extension of 74°C for 5 min (10).Variation within the s1 allele was determined by using the primers SS1-F (5ЈGTCAGCATCACACCGCAAC3Ј), SS3-F (5ЈAGCGCCATACCGCAAGAG3Ј), SS2-F (5ЈGCTAACAC GCCAAATGATCC3Ј), and VA1-R (5ЈCTGCTTGAATGCG CCAAAC3Ј), which generate a 190-bp amplicon for the s1a allele (SS1F and VA1R), a 187-bp amplicon for the s1b allele (SS3F and VA1R), and a 199-bp amplicon for the s2 allele. The cycle parameters were 95°C for 5 min (1 cycle) followed by 35 cycles of 95°C for 1 min, 52°C for 1 min, and 72°C for 1 min (8). The s1c...

No abstract