All infected HCW whose condition had progressed severely and who had failed to respond to the available treatment, survived after transfusion with convalescent plasma.

Severe acute respiratory syndrome-coronavirus 2 (SARS-CoV-2) has spread rapidly, causing deaths worldwide. In this study, we evaluated the performance of the BD MAX Open System module for identifying viral pathogens, including SARS-CoV-2, in nasopharyngeal specimens from individuals with symptoms of upper respiratory tract infection. We developed and validated a rapid total nucleic acid extraction method based on real-time reverse transcription-polymerase chain reaction (RT-PCR) for the reliable, high-throughput simultaneous detection of common cold viral pathogens using the BD MAX Platform. The system was evaluated using 205 nasopharyngeal swab clinical samples. For assessment of the limit of detection (LoD), we used SARS-CoV-2, influenza A/B, and respiratory syncytial virus (RSV) RNA standards. The BD MAX dual multiplex real-time RT-PCR panel demonstrated a sensitivity comparable to that of the World Health Organization-recommended SARS-CoV-2 assay with an LoD of 50 copies/PCR. The LoD of influenza A/B and RSV was 100-200 copies/PCR. The overall percent agreement between the BD MAX panel and laboratory-developed RT-PCR test on 55 SARS-CoV-2-positive clinical samples was 100%; no cross-reactions were encountered. Among the 55 positive cases of COVID-19 analysed, no coinfection was detected. The BD MAX rapid multiplex PCR provides a highly sensitive, robust, and accurate assay for the rapid detection of SARS-CoV-2, influenza A/B, and RSV. Our assay could accurately identify SARS-CoV-2 and other common respiratory viral infections, shortening the turnaround time, and could thus increase the effectiveness of control and prevention measures for this emerging infectious disease.

Over-expression of AdeABC efflux pump stimulated continuously by the mutated AdeRS two component system has been found to result in antimicrobial resistance, even tigecycline (TGC) resistance, in multidrug-resistant Acinetobacter baumannii (MRAB). Although the insertion sequence, ISAba1, contributes to one of the AdeRS mutations, the detail mechanism remains unclear. In the present study we collected 130 TGC-resistant isolates from 317 carbapenem resistant MRAB (MRAB-C) isolates, and 38 of them were characterized with ISAba1 insertion in the adeS gene. The relationship between the expression of AdeABC efflux pump and TGC resistant was verified indirectly by successfully reducing TGC resistance with NMP, an efflux pump inhibitor. Further analysis showed that the remaining gene following the ISAba1 insertion was still transcribed to generate a truncated AdeS protein by the Pout promoter on ISAba1 instead of frame shift or pre-termination. Through introducing a series of recombinant adeRS constructs into a adeRS knockout strain, we demonstrated the truncated AdeS protein was constitutively produced and stimulating the expression of AdeABC efflux pump via interaction with AdeR. Our findings suggest a mechanism of antimicrobial resistance induced by an aberrant cytoplasmic sensor derived from an insertion element.

Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real-time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5'TTACCGGGCTCTGCCATCT3'-TAMRA and VIC-5'AGCAATAACAGGTCTGTGATG3'-TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5-20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age-matched group, and about 10% of patients had muscle mtDNA levels 2- to 16-fold higher than the mean of the age-matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.

We have designed a universal PCR capable of amplifying a portion of the 16S rRNA gene of eubacteria, including Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus pneumoniae, Enterococcus faecium, Enterococcus faecalis, Mycobacterium tuberculosis, Legionella pneumophila, Escherichia coli, Klebsiella pneumoniae, Serratia marcescens, Enterobacter cloacae, Pseudomonas aeruginosa, Acinetobacter baumannii, Proteus mirabilis, Haemophilus influenzae, and Neisseria meningitidis.The sizes of the amplified products from various bacteria were the same (996 bp), but the restriction patterns of most PCR products generated by HaeIII digestion were different. PCR products from S. aureus and S. epidermidis could not be digested by HaeIII but yielded different patterns when they were digested with MnlI. PCR products from S. pneumoniae, E. faecium, and E. faecalis yielded the same HaeIII digestion pattern but could be differentiated by AluI digestion . PCR products from E. coli, K. pneumoniae, S. marcescens, and E. cloacae also had the same HaeIII digestion pattern but had different patterns when digested with DdeI or BstBI. This universal PCR could detect as few as 10 E. coli or 250 S. aureus organisms. Compared with culture, the sensitivity of this universal PCR for detection and identification of bacteria directly from 150 cerebrospinal fluids was 92.3%. These results suggest that this universal PCR coupled with restriction enzyme analysis can be used to detect and identify bacterial pathogens in clinical specimens.

Leber hereditary optic neuropathy (LHON)/pediatric onset dystonia is associated with a G to A transition at nucleotide position (np) 14459, within the mitochondrial DNA (mtDNA)-encoded ND6 gene. This mutation has been reported in families presenting with LHON alone, LHON plus dystonia, or pediatric dystonia with typical age of onset less than 5 years. The mutation changes a moderately conserved alanine to a valine at amino acid residue 72, which is within the most evolutionarily conserved region of the ND6 protein. Pediatric onset disease is associated with basal ganglia dysfunction, spasticity, and encephalopathy. We report a family with G14459A mtDNA mutation and a broad spectrum of clinical manifestation. The proband was a 3-year-old girl with anarthria, dystonia, spasticity, and mild encephalopathy. MRI of the brain demonstrated bilateral, symmetric basal ganglia lucencies associated with cerebral and systemic lactic acidosis. Her maternal first cousin presented with a new onset limp and mild hemiparesis along with similar MRI findings with a much milder phenotype. Additional investigation of the family members with the mutation has revealed both asymptomatic and symptomatic individuals with variable clinical and laboratory features of mitochondrial disease. This study re-emphasizes the heterogeneous clinical manifestation of homoplasmic G14459A mtDNA mutation even within the same family, and supports the hypothesis that nuclear genes may play a role in modifying the clinical expression of mitochondrial disease. Published 2003 Wiley-Liss, Inc.

Tigecycline (TGC)-resistant extensively drug-resistant Acinetobacter baumannii (XDRAB) is an increasing threat in regard to nosocomial infections. The resistance-nodulation-cell division (RND) efflux pump has played an important role in TGC resistance. In this study, total 81 TGC-resistant XDRAB isolates were analyzed for their responses to the efflux pump inhibitor 1-(1-naphthylmethyl)-piperazine (NMP). We found that NMP could reduce by 4-fold or greater than 4-fold the minimum inhibitory concentration (MIC) of TGC in 45 isolates (55.6 %). After typing with pulsed-field gel electrophoresis (PFGE), group A appeared to be the major cluster with good synergistic response to NMP. Transcripts of the AdeABC efflux pump gene were consistently more correlated with TGC resistance than transcripts of the AdeFGJ or AdeIJK efflux pump genes in these isolates. Of the 81 isolates, the amino acid sequences of AdeR and AdeS were further classified and combined into 31 different codes. Although the dissemination of TGC-resistant XDRAB isolates was genetically diverse in our hospital, their responses to NMP conversion were still strain-dependent. We found that AdeRS combination codes were better than PFGE typing in separating groups of isolates with different sensitivity to NMP conversion.

COVID-19 has spread globally. SARS-CoV-2 variants of concern (VOCs) are leading the next waves of the COVID-19 pandemic.