Ultrastructural and lectin-binding studies have established that the melanotic encapsulation reaction of Aedes aegypti Liverpool strain against inoculated Dirofilaria immitis microfilariae (mff) is a hemocyte-mediated reaction. Total hemocyte counts from mff-inoculated (= immune-activated), saline-inoculated, and uninoculated female A. aegypti were determined using a hemocoel perfusion technique. Total hemocyte populations in uninoculated mosquitoes were significantly larger in younger mosquitoes, but no significant change was noted as mosquitoes aged beyond 14 days. Hemocyte populations in immune-activated mosquitoes increased from 1 to 3 days postinoculation (PI) and decreased on days 4 and 5 PI. Hemocyte populations at 1 to 4 days PI were significantly elevated in mff-inoculated A. aegypti as compared with saline-inoculated controls. Saline-inoculated mosquitoes displayed little change in total hemocyte numbers from 1 to 5 days PI, and their hemocyte populations were similar to those seen in uninoculated insects of the same age. Experiments involving the inoculation of [3H]thymidine along with mff or saline alone and studies involving the administration of colchicine suggest that increased hemocyte populations in immune-activated A. aegypti are a result of mitotic division of circulating blood cells.
The molecular basis for several apparent restriction fragment length polymorphisms of the porcine growth hormone gene was examined through DNA sequence analysis. Electrophoretic and sequence analysis suggest polymorphisms result from 1-3 base substitutions that affect double-strand DNA conformation and electrophoretic mobility. Two allelic forms of the porcine growth hormone 5'flank and four allelic forms of the second exonlintron region were identified. A marker system was developed which combined conformation polymorphisms with HaeII and DdeI RFLPs. Using this system, nine haplotypes were observed in samples from three US swine breeds. The data presented suggest that double-strand DNA conformation can be exploited in base substitution detection and development of highly polymorphic genetic marker systems.
Description: Insertions were detected in the 5' flank and second intron of the porcine growth hormone gene by analysis of polymerase chain reaction (PCR) products. An 842-bp segment of the porcine growth hormone gene encompassing base 48 of the 5' flank to base 889 of the third exon (Vize & Wells 1987) was amplified by nested PCR. DNA amplification was performed with Taq polymerase according to the manufacturer's recommendations (AmpliTaq, Perkin-Elmer Cetus, Norwalk, CT) with the following cycle: incubation at 95°C for 1 min, 58°C for 45 s and 72°C for 1 min. PCR was performed in a COY therma! cycler. Oligonucleotide primers were designed for minimal intra-and inter-primer complementarity (5' primer: AGGAGGTTCTAAA'ITATCCAT; 3' primer: GCCACTCACCGATGTCTGCT; 3' nested primer: CTGTCCCTCCGGGATGTAG). Initially, a 941-bp segment was amplified with 5' and 3' primers. To improve yield and quality of the product a second, nested amplification was performed with the 5' primer and 3' nested primer. Amplified DNA was subject to restriction digest, acrylamide gel electrophoresis and visualization by ethidium bromide staining. Results were recorded on Polaroid Type 55 film following exposure to UV light. Two polymorphisms were observed following digestion of amplified DNA with restriction endonucleases PstI, MseI, Hue11 and EcoRI. Occurrence of two polymorphisms with each enzyme indicated the presence of insertionsldeletions. Insertions were subsequently mapped to the 5' flank and second intron.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.