Detection of insertion polymorphisms in 5‘ flank and second intron of the porcine growth hormone gene

Abstract

Description: Insertions were detected in the 5' flank and second intron of the porcine growth hormone gene by analysis of polymerase chain reaction (PCR) products. An 842-bp segment of the porcine growth hormone gene encompassing base 48 of the 5' flank to base 889 of the third exon (Vize & Wells 1987) was amplified by nested PCR. DNA amplification was performed with Taq polymerase according to the manufacturer's recommendations (AmpliTaq, Perkin-Elmer Cetus, Norwalk, CT) with the following cycle: incubation at 95°C for 1 min, 58°C for 45 s and 72°C for 1 min. PCR was performed in a COY therma! cycler. Oligonucleotide primers were designed for minimal intra-and inter-primer complementarity (5' primer: AGGAGGTTCTAAA'ITATCCAT; 3' primer: GCCACTCACCGATGTCTGCT; 3' nested primer: CTGTCCCTCCGGGATGTAG). Initially, a 941-bp segment was amplified with 5' and 3' primers. To improve yield and quality of the product a second, nested amplification was performed with the 5' primer and 3' nested primer. Amplified DNA was subject to restriction digest, acrylamide gel electrophoresis and visualization by ethidium bromide staining. Results were recorded on Polaroid Type 55 film following exposure to UV light. Two polymorphisms were observed following digestion of amplified DNA with restriction endonucleases PstI, MseI, Hue11 and EcoRI. Occurrence of two polymorphisms with each enzyme indicated the presence of insertionsldeletions. Insertions were subsequently mapped to the 5' flank and second intron.

Double‐strand DNA conformation polymorphisms as a source of highly polymorphic genetic markers

“…In following up our initial report of the pGH polymorphisms (Kirkpatrick & Huff 1990) it became clear that observed RFLPs were not the result of insertions as originally suggested. Preliminary sequence analysis indicated instead that the apparent differences in fragment size might result from individual base substitutions and their effects on electrophoretic mobility.…”

Association of chicken growth hormone polymorphisms with egg production

“…This is because GH modulates steroidogenesis, gametogenesis, and gonadal differentiation, as well as gonadotrophin secretion and responsiveness (Zachmann, 1992). Many polymorphisms have been identified in the GH gene of farm animals, including pigs (Kirkpatrick and Huff, 1991;Franco et al, 2005), bovine (Lucy et al, 1993;Grochowska et al, 2001), and goat (Malveiro et al, 2001). Compared to other animals, the intron regions of the cGH gene is highly polymorphic.…”