ObjectiveTo explore the experiences of adolescents with type 1 diabetes mellitus (T1DM) and their parents taking part in an overnight closed loop study at home, using qualitative and quantitative research methods.Research design and methodsAdolescents aged 12–18 years on insulin pump therapy were recruited to a pilot closed loop study in the home setting. Following training on the use of a study insulin pump and continuous glucose monitoring (CGM), participants were randomized to receive either real-time CGM combined with overnight closed loop or real-time CGM alone followed by the alternative treatment for an additional 21 days with a 2–3-week washout period in between study arms. Semistructured interviews were performed to explore participants’ perceptions of the impact of the closed loop technology. At study entry and again at the end of each 21-day crossover arm of the trial, participants completed the Diabetes Technology Questionnaire (DTQ) and Hypoglycemia Fear Survey (HFS; also completed by parents).Results15 adolescents and 13 parents were interviewed. Key positive themes included reassurance/peace of mind, confidence, ‘time off’ from diabetes demands, safety, and improved diabetes control. Key negative themes included difficulties with calibration, alarms, and size of the devices. DTQ results reflected these findings. HFS scores were mixed.ConclusionsClosed loop insulin delivery represents cutting-edge technology in the treatment of T1DM. Results indicate that the psychological and physical benefits of the closed loop system outweighed the practical challenges reported. Further research from longitudinal studies is required to determine the long-term psychosocial benefit of the closed loop technology.
Antibodies to complement factor H are an uncommon cause of hemolytic uremic syndrome (HUS). Information on clinical features and outcomes in children is limited. In order to explore this we studied a multicenter cohort of 138 Indian children with anti-complement factor H antibody associated HUS, constituting 56% of patients with HUS. Antibody titers were high (mean 7054 AU/ml) and correlated inversely with levels of complement C3, but not complement factor H. Homozygous deletion of the CFHR1 gene was found in 60 of 68 patients. Therapies included dialysis in 119 children, 105 receiving plasma exchanges and 26 intravenous immunoglobulin. Induction immunosuppression consisted of 87 children receiving prednisolone with or without intravenous cyclophosphamide or rituximab. Antibody titers fell significantly following plasma exchanges and increased during relapses. Adverse outcome (stage 4-5 CKD or death) was seen in 36 at 3 months and 41 by last follow up, with relapse in 14 of 122 available children. Significant independent risk factors for adverse outcome were an antibody titer over 8000 AU/ml, low C3 and delay in plasma exchange. Combined plasma exchanges and induction immunosuppression resulted in significantly improved renal survival: one adverse outcome prevented for every 2.6 patients treated. Maintenance immunosuppressive therapy, of prednisolone with either mycophenolate mofetil or azathioprine, significantly reduced the risk of relapses. Thus, prompt use of immunosuppressive agents and plasma exchanges are useful for improving outcomes in pediatric patients with anti-complement factor H-associated HUS.
In the original article, the RT-PCR primer sequences listed in Methods were incorrectly labeled as Pkd1. The correct primer sequences for Pkd1 are in the revised paragraph below. Quantitative PCR and reverse transcription PCR. RNA was isolated from cultured cells using Trizol Reagent (Invitrogen). cDNA was reverse transcribed from RNA using reagents from New England Biolabs. Primers for Pkd1 quantitative PCR (forward, GCTA-CAGGGCATCCTGGTG; reverse, GGCTGTCAGCGAGAGCTTGAA) were designed using NCBI's primer-designing tool (http://www. ncbi.nlm.nih.gov/tools/primer-blast/). Quantitative PCR was done by Bio-Rad CFX Connect Real-Time PCR Detection System. Primers for Xbp1 RT-PCR have been published previously (1).
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.