Mechanisms of acquired resistance to immune checkpoint inhibitors (ICIs) are poorly understood. We leveraged a collection of 14 ICI-resistant lung cancer samples to investigate whether alterations in genes encoding HLA Class I antigen processing and presentation machinery (APM) components or interferon signaling play a role in acquired resistance to PD-1 or PD-L1 antagonistic antibodies. Recurrent mutations or copy number changes were not detected in our cohort. In one case, we found acquired homozygous loss of B2M that caused lack of cell surface HLA class I expression in the tumor and a matched patient-derived xenograft (PDX). Downregulation of B2M was also found in two additional PDXs established from ICI-resistant tumors. CRISPR-mediated knock-out of B2m in an immunocompetent lung cancer mouse model conferred resistance to PD-1 blockade in vivo proving its role in resistance to ICIs. These results indicate that HLA Class I APM disruption can mediate escape from ICIs in lung cancer.

No abstract

Idiopathic pulmonary fibrosis (IPF) is an age-related disease featuring progressive lung scarring. To elucidate the molecular basis of IPF, we performed exome sequencing of familial pulmonary fibrosis kindreds. Gene burden analysis comparing 78 European cases and 2,816 controls implicated PARN, an exoribonuclease with no prior connection to telomere biology or disease, with five novel heterozygous damaging mutations in unrelated cases and none in controls (P-value = 1.3 × 10−8); mutations were shared by all affected relatives (odds in favor of linkage = 4,096:1). RTEL1, an established locus for dyskeratosis congenita, harbored significantly more novel damaging and missense variants at conserved residues in cases than controls (P = 1.6 × 10−6). PARN and RTEL1 mutation carriers had shortened leukocyte telomere lengths and epigenetic inheritance of short telomeres was seen in family members. Together these genes explain ~7% of familial pulmonary fibrosis and strengthen the link between lung fibrosis and telomere dysfunction.

Background Although EGFR mutant tumors exhibit low response rates to immune checkpoint blockade overall, some EGFR mutant tumors do respond to these therapies; however, there is a lack of understanding of the characteristics of EGFR mutant lung tumors responsive to immune checkpoint blockade. Patients and methods We retrospectively analyzed de-identified clinical and molecular data on 171 cases of EGFR mutant lung tumors treated with immune checkpoint inhibitors from the Yale Cancer Center, Memorial Sloan Kettering Cancer Center, University of California Los Angeles, and Dana Farber Cancer Institute. A separate cohort of 383 EGFR mutant lung cancer cases with sequencing data available from the Yale Cancer Center, Memorial Sloan Kettering Cancer Center, and The Cancer Genome Atlas was compiled to assess the relationship between tumor mutation burden and specific EGFR alterations. Results Compared with 212 EGFR wild-type lung cancers, outcomes with programmed cell death 1 or programmed death-ligand 1 (PD-(L)1) blockade were worse in patients with lung tumors harboring alterations in exon 19 of EGFR ( EGFR Δ19 ) but similar for EGFR L858R lung tumors. EGFR T790M status and PD-L1 expression did not impact response or survival outcomes to immune checkpoint blockade. PD-L1 expression was similar across EGFR alleles. Lung tumors with EGFR Δ19 alterations harbored a lower tumor mutation burden compared with EGFR L858R lung tumors despite similar smoking history. Conclusions EGFR mutant tumors have generally low response to immune checkpoint inhibitors, but outcomes vary by allele. Understanding the heterogeneity of EGFR mutant tumors may be informative for establishing the benefits and uses of PD-(L)1 therapies for patients with this disease.

Intracellular colonization and persistent infection by the kinetoplastid protozoan parasite, Trypanosoma cruzi, underlie the pathogenesis of human Chagas disease. To obtain global insights into the T. cruzi infective process, transcriptome dynamics were simultaneously captured in the parasite and host cells in an infection time course of human fibroblasts. Extensive remodeling of the T. cruzi transcriptome was observed during the early establishment of intracellular infection, coincident with a major developmental transition in the parasite. Contrasting this early response, few additional changes in steady state mRNA levels were detected once mature T. cruzi amastigotes were formed. Our findings suggest that transcriptome remodeling is required to establish a modified template to guide developmental transitions in the parasite, whereas homeostatic functions are regulated independently of transcriptomic changes, similar to that reported in related trypanosomatids. Despite complex mechanisms for regulation of phenotypic expression in T. cruzi, transcriptomic signatures derived from distinct developmental stages mirror known or projected characteristics of T. cruzi biology. Focusing on energy metabolism, we were able to validate predictions forecast in the mRNA expression profiles. We demonstrate measurable differences in the bioenergetic properties of the different mammalian-infective stages of T. cruzi and present additional findings that underscore the importance of mitochondrial electron transport in T. cruzi amastigote growth and survival. Consequences of T. cruzi colonization for the host include dynamic expression of immune response genes and cell cycle regulators with upregulation of host cholesterol and lipid synthesis pathways, which may serve to fuel intracellular T. cruzi growth. Thus, in addition to the biological inferences gained from gene ontology and functional enrichment analysis of differentially expressed genes in parasite and host, our comprehensive, high resolution transcriptomic dataset provides a substantially more detailed interpretation of T. cruzi infection biology and offers a basis for future drug and vaccine discovery efforts.

Premature fusion of the cranial sutures (craniosynostosis), affecting 1 in 2000 newborns, is treated surgically in infancy to prevent adverse neurologic outcomes. To identify mutations contributing to common non-syndromic midline (sagittal and metopic) craniosynostosis, we performed exome sequencing of 132 parent-offspring trios and 59 additional probands. Thirteen probands (7%) had damaging de novo or rare transmitted mutations in SMAD6, an inhibitor of BMP -induced osteoblast differentiation (p<10 À20 ). SMAD6 mutations nonetheless showed striking incomplete penetrance (<60%). Genotypes of a common variant near BMP2 that is strongly associated with midline craniosynostosis explained nearly all the phenotypic variation in these kindreds, with highly significant evidence of genetic interaction between these loci via both association and analysis of linkage. This epistatic interaction of rare and common variants defines the most frequent cause of midline craniosynostosis and has implications for the genetic basis of other diseases.

Carcinosarcomas (CSs) of the uterus and ovary are highly aggressive neoplasms containing both carcinomatous and sarcomatous elements. We analyzed the mutational landscape of 68 uterine and ovarian CSs by whole-exome sequencing. We also performed multiregion whole-exome sequencing comprising two carcinoma and sarcoma samples from six tumors to resolve their evolutionary histories. The results demonstrated that carcinomatous and sarcomatous elements derive from a common precursor having mutations typical of carcinomas. In addition to mutations in cancer genes previously identified in uterine and ovarian carcinomas such as TP53, PIK3CA, PPP2R1A, KRAS, PTEN, CHD4, and BCOR, we found an excess of mutations in genes encoding histone H2A and H2B, as well as significant amplification of the segment of chromosome 6p harboring the histone gene cluster containing these genes. We also found frequent deletions of the genes TP53 and MBD3 (a member with CHD4 of the nucleosome remodeling deacetylase complex) and frequent amplification of chromosome segments containing the genes PIK3CA, TERT, and MYC. Stable transgenic expression of H2A and H2B in a uterine serous carcinoma cell line demonstrated that mutant, but not wild-type, histones increased expression of markers of epithelial-mesenchymal transition (EMT) as well as tumor migratory and invasive properties, suggesting a role in sarcomatous transformation. Comparison of the phylogenetic relationships of carcinomatous and sarcomatous elements of the same tumors demonstrated separate lineages leading to these two components. These findings define the genetic landscape of CSs and suggest therapeutic targets for these highly aggressive neoplasms.uterine carcinosarcoma | ovarian carcinosarcoma | exome sequencing C arcinosarcomas (CSs) of the female genital tract, also known as mixed malignant Müllerian tumors, are rare but highly aggressive tumors characterized by a biphasic histology. These cancers most commonly arise in the uterus, followed by the ovaries, fallopian tubes, and vagina (1-3). The diagnosis of CS requires the presence of both sarcomatous and carcinomatous components. Although the pathogenesis of CSs remains under debate, an increasing body of evidence supports the origin of both elements from a common epithelial cell that undergoes sarcomatous dedifferentiation, rather than two independent progenitors (2-5).The overall 5-y survival is only 30 ± 9% for all stages, and the recurrence rate after surgery is extremely high (50-80%) (3-5). The uncertain origin and poor prognosis of uterine and ovarian CSs motivate determination of the molecular basis of CS aggressive behavior in the hope of developing novel and effective treatment modalities. ResultsThe Genetic Landscape of CS. A total of 68 patients with stage I-IV uterine (n = 44) and ovarian (n = 24) CSs were studied. Their clinical and histological features are presented in SI Appendix, Table S1. Upon surgical removal of tumors, primary cell lines were prepared (five tumors) or tumors were frozen (63 tumors). Among t...

In the original article, the RT-PCR primer sequences listed in Methods were incorrectly labeled as Pkd1. The correct primer sequences for Pkd1 are in the revised paragraph below. Quantitative PCR and reverse transcription PCR. RNA was isolated from cultured cells using Trizol Reagent (Invitrogen). cDNA was reverse transcribed from RNA using reagents from New England Biolabs. Primers for Pkd1 quantitative PCR (forward, GCTA-CAGGGCATCCTGGTG; reverse, GGCTGTCAGCGAGAGCTTGAA) were designed using NCBI's primer-designing tool (http://www. ncbi.nlm.nih.gov/tools/primer-blast/). Quantitative PCR was done by Bio-Rad CFX Connect Real-Time PCR Detection System. Primers for Xbp1 RT-PCR have been published previously (1).