No abstract

A simple and straightforward synthesis of the pyrimidine 2′-deoxyribonucleoside cyclic Nacylphosphoramidites R P -1 and S P -1 is described. Specifically, (()-2-amino-1-phenylethanol 2 was chemoselectively N-acylated to 4 by treatment with ethyl fluoroacetate 3 followed by reaction with hexaethylphosphorus triamide to afford the cyclic N-acylphosphoramidite 5 as a mixture of diastereomeric rotamers (5a and 5b). Condensation of N 4 -benzoyl-5′-O-(4,4′-dimethoxytrityl)-2′-deoxycytidine 8 with 5 in the presence of 1Htetrazole gave, after silica gel chromatography, pure R P -1 and S P -1. 31 P NMR studies indicated that when R P -1 or S P -1 is reacted with 3′-O-acetylthymidine and N,N,N′,N′-tetramethylguanidine in CD 3 CN, the dinucleoside phosphotriester S P -9 or R P -9 is formed in near quantitative yield with total P-stereospecificity (δ P 144.2 or 143.9 ppm, respectively). Sulfurization of S P -9 or R P -9 generated the P-stereodefined dinucleoside phosphorothioate R P -11 or S P -11 (δ P 71.0 or 71.2 ppm, respectively). The 2′-deoxycytidine cyclic N-acylphosphoramidite derivatives R P -1 and S P -1 were subsequently applied to the solid-phase synthesis of [R P ,R P ]-and [S P ,S P ]-trideoxycytidilyl diphosphorothioate d(C PS C PS C), and [R P ,S P ,R P ]-tetradeoxycytidilyl triphosphorothioate d(C PS C PS C PS C). Following deprotection, reversed-phase (RP) HPLC analysis of these oligonucleotide analogues showed a single peak for each oligomer. By comparison, RP-HPLC analysis of purified P-diastereomeric d(C PS C PS C) and d(C PS C PS C PS C) prepared from standard 2-cyanoethyl deoxyribonucleoside phosphoramidites exhibited 4 and 8 peaks, respectively, each peak corresponding to a specific P-diastereomer (see Figure 3A). The thymidine cyclic N-acylphosphoramidite derivatives R P -14 and S P -14 were also prepared, purified, and used successfully in the solid-phase synthesis of [R P ] 11 -d[(T PS ) 11 T]. Thus, the application of deoxyribonucleoside cyclic N-acyl phosphoramidites to P-stereocontrolled synthesis of oligodeoxyribonucleoside phosphorothioates may offer a compelling alternative to the methods currently used for such syntheses.

The synthesis and separation of diastereoisomerically pure 5'-O-DMT-nucleoside 3'-0-(2-thio-1 ,3,2-oxathiaphospholane) allows their use as synthons in DBUcatalyzed reaction with the 5'-hydroxyl function of solid-support-bound nucleoside moiety. Since this reaction is stereospecific (>99%), this novel method allows preparation of oligo(nucleoside phosphorothioates) (1) with predetermined chirality at each P-chiral internucleotide phosphorothioate centre.

The cyclic dinucleotides 3'-5'diadenylate (c-diAMP) and 3'-5' diguanylate (c-diGMP) are important bacterial second messengers that have recently been shown to stimulate the secretion of type I Interferons (IFN-Is) through the c-diGMP-binding protein MPYS/STING. Here, we show that physiologically relevant levels of cyclic dinucleotides also stimulate a robust secretion of IL-1b through the NLRP3 inflammasome. Intriguingly, this response is independent of MPYS/STING. Consistent with most NLRP3 inflammasome activators, the response to c-diGMP is dependent on the mobilization of potassium and calcium ions. However, in contrast to other NLRP3 inflammasome activators, this response is not associated with significant changes in mitochondrial potential or the generation of mitochondrial reactive oxygen species. Thus, cyclic dinucleotides activate the NLRP3 inflammasome through a unique pathway that could have evolved to detect pervasive bacterial pathogen-associated molecular patterns associated with intracellular infections.

[reaction in text] The 2-(N-formyl-N-methyl)aminoethyl deoxyribonucleoside phosphoramidite 1 has been synthesized and used in the solid-phase synthesis of an octadecathymidylic acid as a cost-efficient monomer for potential application in the preparation of therapeutic oligonucleotides. The 2-(N-formyl-N-methyl)aminoethyl group can be cleaved from oligonucleotides according to a unique thermolytic cyclodeesterification process at pH 7.0. In addition to being cost-effective, the use of 1 simplifies oligonucleotide postsynthesis processing by eliminating the utilization of concentrated ammonium hydroxide in oligonucleotide deprotection.

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

No abstract

The detailed preparation of deoxyribonucleoside phosphoramidites bearing a 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl group for P(III) protection is presented. The use of this group circumvents nucleobase alkylation during oligonucleotide deprotection. Two syntheses of phosphoramidites starting from either a phosphordichloridite precursor or a bis-(N,N-diisopropylamino)chlorophosphine intermediate are described for the phosphinylation of suitably protected deoxyribonucleosides.