[reaction in text] The 2-(N-formyl-N-methyl)aminoethyl deoxyribonucleoside phosphoramidite 1 has been synthesized and used in the solid-phase synthesis of an octadecathymidylic acid as a cost-efficient monomer for potential application in the preparation of therapeutic oligonucleotides. The 2-(N-formyl-N-methyl)aminoethyl group can be cleaved from oligonucleotides according to a unique thermolytic cyclodeesterification process at pH 7.0. In addition to being cost-effective, the use of 1 simplifies oligonucleotide postsynthesis processing by eliminating the utilization of concentrated ammonium hydroxide in oligonucleotide deprotection.

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

The detailed preparation of deoxyribonucleoside phosphoramidites bearing a 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl group for P(III) protection is presented. The use of this group circumvents nucleobase alkylation during oligonucleotide deprotection. Two syntheses of phosphoramidites starting from either a phosphordichloridite precursor or a bis-(N,N-diisopropylamino)chlorophosphine intermediate are described for the phosphinylation of suitably protected deoxyribonucleosides.

No abstract

Thermolytic groups structurally related to well-studied heat-sensitive phosphate/thiophosphate protecting groups have been evaluated for 5'-hydroxyl protection of deoxyribonucleosides as carbonates and for potential use in solid-phase oligonucleotide synthesis. The spatial arrangement of selected functional groups forming an asymmetric nucleosidic 5'-O-carbonic acid ester has been designed to enable heat-induced cyclodecarbonation reactions, which would result in the release of carbon dioxide and the generation of a nucleosidic 5'-hydroxyl group. The nucleosidic 5'-O-carbonates 3-8, 10-15, and 19-21 were prepared and were isolated in yields ranging from 45 to 83%. Thermolytic deprotection of these carbonates is preferably performed in aqueous organic solvent at 90 degrees C under near neutral conditions. The rates of carbonate deprotection are dependent on the nucleophilicity of the functional group involved in the postulated cyclodecarbonation reaction and on solvent polarity. Deprotection kinetics increase according to the following order: 4 < 5 < 10 < 6 < 12 < 7 < 13 < 8 < 14 congruent with 19-21 and CCl4 < dioxane < MeCN < t-BuOH < MeCN:phosphate buffer (3:1 v/v, pH 7.0) < EtOH:phosphate buffer (1:1 v/v, pH 7.0). Complete thermolytic deprotection of carbonates 7, 8, 13, and 14 is achieved within 20 min to 2 h under optimal conditions in phosphate buffer-MeCN. The 2-(2-pyridyl)amino-1-phenylethyl and 2-[N-methyl-N-(2-pyridyl)]aminoethyl groups are particularly promising for 5'-hydroxyl protection of deoxyribonucleosides as thermolytic carbonates.

No abstract

A new method for attaining higher stability of thermolabile protecting groups (TPG) using an intramolecular cyclization through a "click-clack" approach was demonstrated. It was found that during intramolecular cyclization of 2-pyridyl type of TPG the thermally stable 3-pyridyl-[1,3,2]oxazaphospholidine ring was formed and thermolabile properties were declined. Thermolability could be recovered upon hydrolytic ring-opening of a 3-pyridyl-[1,3,2]oxazaphospholidine. "Click-clack" chemistry was applied to the synthesis of biologically important phosphate esters and their analogues and some H-phosphonate derivatives.

The copper-catalyzed alkyne-azide cycloaddition (CuAAC) reaction was applied as the novel method of DNA immobilization on a modified solid support. The CuAAC click reaction enables the covalent binding of DNA modified with pentynyl groups at its 5'-end to azide-loaded slides. Click microarrays were produced using this approach and successfully employed in biological/model experiments.