CGD is an immunodeficiency caused by deletions or mutations in genes that encode subunits of the leukocyte NADPH oxidase complex. Normally, assembly of the NADPH oxidase complex in phagosomes of certain phagocytic cells leads to a “respiratory burst”, essential for the clearance of phagocytosed micro-organisms. CGD patients lack this mechanism, which leads to life-threatening infections and granuloma formation. However, a clear picture of the clinical course of CGD is hampered by its low prevalence (∼1∶250,000). Therefore, extensive clinical data from 429 European patients were collected and analyzed. Of these patients 351 were males and 78 were females. X-linked (XL) CGD (gp91phox deficient) accounted for 67% of the cases, autosomal recessive (AR) inheritance for 33%. AR-CGD was diagnosed later in life, and the mean survival time was significantly better in AR patients (49.6 years) than in XL CGD (37.8 years), suggesting a milder disease course in AR patients. The disease manifested itself most frequently in the lungs (66% of patients), skin (53%), lymph nodes (50%), gastrointestinal tract (48%) and liver (32%). The most frequently cultured micro-organisms per episode were Staphylococcus aureus (30%), Aspergillus spp. (26%), and Salmonella spp. (16%). Surprisingly, Pseudomonas spp. (2%) and Burkholderia cepacia (<1%) were found only sporadically. Lesions induced by inoculation with BCG occurred in 8% of the patients. Only 71% of the patients received antibiotic maintenance therapy, and 53% antifungal prophylaxis. 33% were treated with γ-interferon. 24 patients (6%) had received a stem cell transplantation. The most prominent reason of death was pneumonia and pulmonary abscess (18/84 cases), septicemia (16/84) and brain abscess (4/84). These data provide further insight in the clinical course of CGD in Europe and hopefully can help to increase awareness and optimize the treatment of these patients.

Component Affected g p9 1-phox gp91-phox gp91-phox p22-ph0~ p22-phox p47-ph0~ p67-ph0~ Cytochrome 458 Heme Spectrum

The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCAClTICATCITCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron microscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 105 cells after killing of

No abstract

Human neutrophils have a short half-life and are believed to die by apoptosis or programmed cell death both in vivo and in vitro. We found that caspases are activated in a time-dependent manner in neutrophils undergoing spontaneous apoptosis, concomitant with other characteristic features of apoptotic cell death such as morphologic changes, phosphatidylserine (PS) exposure, and DNA fragmentation. The treatment of neutrophils with agonistic anti-Fas monoclonal antibodies (MoAbs) significantly accelerated this process. However, in cells treated with the potent neutrophil activator phorbol 12-myristate 13-acetate (PMA), caspase activity was only evident after pharmacologic inhibition of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Similarily, inhibition of the NADPH oxidase in constitutive and Fas/APO-1–triggered apoptosis resulted in increased rather than suppressed levels of caspase activity, suggesting that reactive oxygen species may prevent caspases from functioning optimally in these cells. Moreover, oxidants generated via the NADPH oxidase were essential for PS exposure during PMA-induced cell death, but not for neutrophils undergoing spontaneous apoptosis. We conclude that caspases are an important component of constitutive and Fas/APO-1–triggered neutrophil apoptosis. However, these redox sensitive enzymes are suppressed in activated neutrophils, and an alternate oxidant-dependent pathway is used to mediate PS exposure and neutrophil clearance under these conditions.

Long interspersed nuclear element-1 (LINE-1) or L1 elements are DNA elements present in the genome in high copy number and capable of active retrotransposition. Here we present a patient with severe chronic granulomatous disease (CGD) caused by insertion of an L1 sequence into intron 5 of the X-lined gene CYBB. Due to internal rearrangements, the insert introduced new splice sites into the intron. This resulted in a highly heterogeneous splicing pattern with introduction of two L1 fragments as new exons into the transcripts and concomitant skipping of exonic coding sequence. Because no wild-type cDNA was found, this mechanism is probably responsible for the patient's phenotype. The L1 fragment, which belongs to the Ta subset of transcriptionally active LINEs, illustrates a new mechanism by which these elements can modify the transcribed coding sequence of genes.

Human neutrophils have a short half-life and are believed to die by apoptosis or programmed cell death both in vivo and in vitro. We found that caspases are activated in a time-dependent manner in neutrophils undergoing spontaneous apoptosis, concomitant with other characteristic features of apoptotic cell death such as morphologic changes, phosphatidylserine (PS) exposure, and DNA fragmentation. The treatment of neutrophils with agonistic anti-Fas monoclonal antibodies (MoAbs) significantly accelerated this process. However, in cells treated with the potent neutrophil activator phorbol 12-myristate 13-acetate (PMA), caspase activity was only evident after pharmacologic inhibition of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Similarily, inhibition of the NADPH oxidase in constitutive and Fas/APO-1–triggered apoptosis resulted in increased rather than suppressed levels of caspase activity, suggesting that reactive oxygen species may prevent caspases from functioning optimally in these cells. Moreover, oxidants generated via the NADPH oxidase were essential for PS exposure during PMA-induced cell death, but not for neutrophils undergoing spontaneous apoptosis. We conclude that caspases are an important component of constitutive and Fas/APO-1–triggered neutrophil apoptosis. However, these redox sensitive enzymes are suppressed in activated neutrophils, and an alternate oxidant-dependent pathway is used to mediate PS exposure and neutrophil clearance under these conditions.

C1q is the central pattern-recognition molecule in the classical pathway of the complement system and is known to have a key role in the crossroads between adaptive and innate immunity. Hereditary C1q deficiency is a rare genetic condition strongly associated with systemic lupus erythematosus and increased susceptibility to bacterial infections. However, the clinical symptoms may vary. For long, the molecular basis of C1q deficiency was ascribed to only six different mutations. In the present report, we describe five new patients with C1q deficiency, present the 12 causative mutations described till now and review the clinical spectrum of symptoms found in patients with C1q deficiency. With the results presented here, confirmed C1q deficiency is reported in 64 patients from at least 38 families.