Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay

Abstract

The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCAClTICATCITCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron microscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 105 cells after killing of

Abundance of intraepithelial γδ T cells in hypertrophic obstructive but not in chronically infected adenoids

“…In mice, intestinal intraepithelial T cells have been shown to be protective against Listeria monocytogenes, an intracellular facultative bacterium [30]. In human adenoid tissue Forsgren and co-workers recently demonstrated that H. influenzae can survive and divide inside adenoid macrophages and epithelial cells [7]. The intracellularly located bacteria are then inaccessible to antibiotics as well as several anti-bacterial immune responses, e.g.…”

“…The nasopharynx of most children is colonized by respiratory tract pathogens such as Streptococcus pneumoniae and Haemophilus influenzae. These bacteria have been implicated in the pathogenesis of secretory otitis media [6,7].…”

Cytokines in nasopharyngeal secretions; evidence for defective IL-1β production in children with recurrent episodes of acute otitis media

“…This suggests that bacteria are harboured in crypts or in the lymphatic tissue [22]. In a recent study it has been possible to demonstrate H. infiuenzae intracellularly in macrophages by electron microscopy and by RNA hybridization [23]. Haemophitus infiuenzae LPS may thus exert a chronic stimulation of local immune reactivity.…”

Systemic humoral immunity to non-typeable Haemophilus influenzae

“…In this circumstance NTHi may attempt to evade the immune response by living intracellularly and thus be sheltered from the bactericidal effect of antibody/complement. Recently the ability of NTHi to live intracellularly in monocytes/macrophages and epithelial cells has been described [2,[45][46][47][48][49][50]. For intracellular infections host defence is reliant upon the cell-mediated immune response of the cytotoxic and helper T lymphocytes.…”